Question: Plant miRNA prediction
0
gravatar for swati25887
4.6 years ago by
swati258870
Canada
swati258870 wrote:

Hi everyone

I am doing a next gen sequencing project to identify miRNA in brassica. I made the small RNA libraries and sent them for sequencing and subsequent analysis. The data that I got back shows a lot of novel miRNAs and also some novel miRNAs with similarity to already known miRNAs in miRbase. For eg. aaaacggaaucguaagcuuc is called siimilar to osa-miR2121a (whose sequence is aaaacggagcgguccauuagcgcg). The similarity between these two miRNAs is between 2-8nt. Same criteria is for other miRNAs.

My question is how should I interpret this data? When doing clustering of miRNAs in families which sequence should I use? I think similarity at seed region can not be used as a criteria for clustering! 

I would welcome any kind of suggestions.

Thanks

mirna next-gen plant • 1.5k views
ADD COMMENTlink modified 3.6 years ago by Biostar ♦♦ 20 • written 4.6 years ago by swati258870
0
gravatar for Saima
4.6 years ago by
Saima10
United States
Saima10 wrote:

By clustering miRNAs, do you mean assigning these to a specific miRNA family based on sequence identity? In case of plants, usually mature miRNAs are assigned to the same family based on perfect or near-perfect sequence matches (allowing 0-4 mismatches according to Meyers et al., 2008 paper ).

ADD COMMENTlink written 4.6 years ago by Saima10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 892 users visited in the last hour