Question: makeblastdb with FASTA file error: "does not match input format type"
0
gravatar for teenie-m
4.7 years ago by
teenie-m0
United States
teenie-m0 wrote:

Hi all - I have been trying to set up a local database with the Drosophila melanogaster genome to use with Blast+ and have been having a lot of trouble. I tried using makeblastdb as follows:

makeblastdb -in dmel-all-chromosome-r6.02.fasta -dbtype nucl

But I always get the following error: "BLAST options error: dmel-all-chromosome-r6.02.fasta does not match input format type, default input type is FASTA"

The thing is, dmel-all-chromosome-r6.02.fasta is a FASTA file. It was downloaded from a reputable source (Flybase) and running the head command produces this output:


>dmel_mitochondrion_genome type=chromosome; loc=dmel_mitochondrion_genome:1..19517; ID=dmel_mitochondrion_genome; dbxref=GB:NC_001709; MD5=61af8db53361cd5744f41f773d21c3d4; length=19517; release=r6.02; species=Dmel;

AATGAATTGCCTGATAAAAAGGATTACCTTGATAGGGTAAATCATGCAGTTTTCTGCATTCATTGACTGATTTATATATT

ATTTATAAAGATGATTTTATATTTAATAGAATTAAACTATTTCTAAAAGTATCAAAAACTTTTGTGCATCATACACCAAA


I also tried the same command with the drosoph.nt FASTA file from ftp://ftp.ncbi.nlm.nih.gov/blast/db/FASTA/ with the same result. Again, there's nothing to suggest (at least to me) that this file is anything but a FASTA file. Any idea what might be going wrong here? 

Thanks,

Christine

blast fasta • 3.0k views
ADD COMMENTlink modified 2.0 years ago by Biostar ♦♦ 20 • written 4.7 years ago by teenie-m0
1
gravatar for Pierre Lindenbaum
4.7 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum120k wrote:

can you please run the following line:

$ file dmel-all-chromosome-r6.02.fasta

 

ADD COMMENTlink written 4.7 years ago by Pierre Lindenbaum120k

Ah, I see - it was a problem with folder permissions. If I use "sudo" before "makeblastdb" it works fine. Thanks so much for the help, sorry for the novice mistake! 

ADD REPLYlink written 4.7 years ago by teenie-m0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1069 users visited in the last hour