makeblastdb with FASTA file error: "does not match input format type"

Question

[teenie-m]

Hi all - I have been trying to set up a local database with the Drosophila melanogaster genome to use with Blast+ and have been having a lot of trouble. I tried using makeblastdb as follows:

makeblastdb -in dmel-all-chromosome-r6.02.fasta -dbtype nucl

But I always get the following error: BLAST options error: dmel-all-chromosome-r6.02.fasta does not match input format type, default input type is FASTA

The thing is, dmel-all-chromosome-r6.02.fasta is a FASTA file. It was downloaded from a reputable source (Flybase) and running the head command produces this output:

>dmel_mitochondrion_genome type=chromosome; loc=dmel_mitochondrion_genome:1..19517; ID=dmel_mitochondrion_genome; dbxref=GB:NC_001709; MD5=61af8db53361cd5744f41f773d21c3d4; length=19517; release=r6.02; species=Dmel;
AATGAATTGCCTGATAAAAAGGATTACCTTGATAGGGTAAATCATGCAGTTTTCTGCATTCATTGACTGATTTATATATT
ATTTATAAAGATGATTTTATATTTAATAGAATTAAACTATTTCTAAAAGTATCAAAAACTTTTGTGCATCATACACCAAA

I also tried the same command with the drosoph.nt FASTA file from ftp://ftp.ncbi.nlm.nih.gov/blast/db/FASTA/ with the same result. Again, there's nothing to suggest (at least to me) that this file is anything but a FASTA file. Any idea what might be going wrong here?

Thanks,
Christine

Answer 1

[Pierre Lindenbaum]

Can you please run the following line:

$ file dmel-all-chromosome-r6.02.fasta

[teenie-m]

Ah, I see - it was a problem with folder permissions. If I use sudo before makeblastdb it works fine. Thanks so much for the help, sorry for the novice mistake!