Entering edit mode
10.9 years ago
biolab
★
1.4k
Dear all
I have two fastq files like below. All headers has 1:N:... so, my first question is: are the reads of both files from single-end sequencing?
@HWI-ST279:279:D1BF5ACXX:6:1101:11959:3172 1:N:0:ACAGTG
TCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGA
+
BCCFFDDFHHHGHJIJJJJHIIJJJJJJJBHIJIJJJFHHIIJJJJIJJJI
My second question relates to mapping method. I am a new user of tophat. Can tophat-cufflink be used for ~60bp single-end reads mapping?
Thanks a lot for your suggestions.
Hi Walnut, Thank you for your help!
You're welcome. And Walnut is a cute name; I could go by that.
OK, Brian. Cheers!