Question: Single-end vs pair-end mapping
0
gravatar for biolab
4.4 years ago by
biolab1.1k
biolab1.1k wrote:

Dear all

I have two fastq files like below.  All headers has 1:N:...  so, my first question is: are the reads of both files from single-end sequencing ?

@HWI-ST279:279:D1BF5ACXX:6:1101:11959:3172 1:N:0:ACAGTG
TCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGA
+
BCCFFDDFHHHGHJIJJJJHIIJJJJJJJBHIJIJJJFHHIIJJJJIJJJI

My second question relates to mapping method.  I am a new user of tophat.  Can tophat-cufflink be used for ~60bp single-end reads mapping? 

Thanks a lot for your suggestions.

 

bowtie tophat • 2.3k views
ADD COMMENTlink modified 4.4 years ago by Brian Bushnell16k • written 4.4 years ago by biolab1.1k
1
gravatar for Brian Bushnell
4.4 years ago by
Walnut Creek, USA
Brian Bushnell16k wrote:

If both end with " 1:N...", then those headers indicate single-ended sequencing.

Tophat+Cufflinks can be used for mapping and analyzing 60bp single-ended reads.  Which does not mean I'd consider them ideal; I think BBMap+Deseq is probably better.

 

ADD COMMENTlink modified 4.4 years ago • written 4.4 years ago by Brian Bushnell16k

Hi Walnut, Thank you for your help!

ADD REPLYlink written 4.4 years ago by biolab1.1k

You're welcome.  And Walnut is a cute name; I could go by that.

ADD REPLYlink written 4.4 years ago by Brian Bushnell16k

OK, Brian. Cheers!

ADD REPLYlink modified 4.4 years ago • written 4.4 years ago by biolab1.1k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1783 users visited in the last hour