Entering edit mode
10.9 years ago
Zhilong Jia
★
2.2k
To find the functionality of A SNP, I'd want to find a tool that can find a kind of SNP-specific motif. The SNP-specific motif means this motif binds one allele of SNP strongly but not the other. Thank you.
That's exactly the tool I seek. but for long sequence, the server is dead. By the way, Is there any other tools like this? Thank you.
example: (from human)
TGTGTGTAAGACATGCAGTCAACAATGAGATGAAGGCCATTGCATAGATCT
andTGTGTGTAAGACATGCAGTCAACAACGAGATGAAGGCCATTGCATAGATCT
.I don't think it's dead. I just tried it with that example and it works. Also you might want to try it with shorter sequences (SNP and 10-15bp on either side) to avoid it timing out on you, and because most binding sites are only 8 ntds long so much more and you'd be scanning more sequence than you need to (e.g the 25 ntd on either side)
You are right. with the tick of SNP Scan box, it works.