Question: what is the Hiseq 2000 adaptor sequences
2
gravatar for hana
5.2 years ago by
hana180
Malaysia
hana180 wrote:

Hi 

I have some RNA samples(paired-end reads) . The cDNA synthesised by TruSeq RNA sample preparation kit and  sequenced by illumina Hiseq 2000 platform .

I would like to use trimmomatic to trim the reads. Can anyone let me know how I can find the adaptor sequence?

thank you

rna-seq • 6.2k views
ADD COMMENTlink modified 5.2 years ago • written 5.2 years ago by hana180
5
gravatar for geek_y
5.2 years ago by
geek_y10k
Barcelona
geek_y10k wrote:

1. You will get this information from the sequencing facility from where the data is generated.

2. Run FASTQC and look at the over represented sequences, which may give the name of the adapter sequence. It looks for different adapters which are listed here: https://github.com/csf-ngs/fastqc/blob/master/Contaminants/contaminant_list.txt

3. Use universal adapter sequences of TruSeq kit. 

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

ADD COMMENTlink modified 5.2 years ago • written 5.2 years ago by geek_y10k
4
gravatar for rtliu
5.2 years ago by
rtliu2.1k
New Zealand
rtliu2.1k wrote:

Personally I would use  /Path-To-Trimmomatic-0.33/adapters/TruSeq3-PE-2.fa

It was included in the binary of Trimmomatic.

 

ADD COMMENTlink written 5.2 years ago by rtliu2.1k
0
gravatar for Charles Plessy
5.2 years ago by
Charles Plessy2.7k
Japan
Charles Plessy2.7k wrote:

Illumina documents adaptor sequences in its "Customer Sequence Letter".

 

ADD COMMENTlink written 5.2 years ago by Charles Plessy2.7k
0
gravatar for ewre
5.2 years ago by
ewre220
United States
ewre220 wrote:

http://supportres.illumina.com/documents/documentation/chemistry_documentation/experiment-design/illumina-customer-sequence-letter.pdf probablity has the answer you are looking for.

sorry, Charles Plessy already give the file I mentioned above, forget about it.

ADD COMMENTlink modified 5.2 years ago • written 5.2 years ago by ewre220
0
gravatar for hana
5.2 years ago by
hana180
Malaysia
hana180 wrote:

thank you so much for sharing the information
 

ADD COMMENTlink written 5.2 years ago by hana180
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1212 users visited in the last hour