Samtools Tview Legend
2
2
Entering edit mode
10.0 years ago
Pascal ★ 1.5k

Hi.

I would like to understand the output screen produced by a "samtools tview". I may not googling with good keywords, but I just can't find any document explaining the meaining of ".", "," underlined characters, etc.

Thanks in advance.

samtools alignment visualization viewer • 8.1k views
ADD COMMENT
4
Entering edit mode
10.0 years ago

See the C in samtools /bam_tview.c

c = bam1_strand(p->b)? ',' : '.'
  • . is for a matching base reverse strand
  • , is for a matching base forward strand
if (((p->b->core.flag&BAM*FPAIRED) && !(p->b->core.flag&BAM*FPROPER*PAIR)) || (p->b->core.flag & BAM*FSECONDARY)) attr |= A_UNDERLINE;
  • an underline tells if the read was correctly paired or/not.
  • etc...
ADD COMMENT
0
Entering edit mode

Oh it's clear now :->

ADD REPLY
0
Entering edit mode

Thank you Pierre!

ADD REPLY
4
Entering edit mode
8.1 years ago
Puriney ▴ 330

I disagree with @Pierre.

, : negative strand,

. : positive strand.

You could try to separate the reads by its strand using the bitwise flag.

samtools -f 0x10 -b aln.bam> aln.neg.bam would give you all the reads mapped to negative strand,

samtools -F 0x10 -b aln.bam>aln.pos.bam would give the positive reads.

Then you could use samtools tview to see them. Due to alternative splicing, the RNA-seq reads would normally have 123N, for example, in their cigar string, which means skipped reads, a.k.a splicing junction spanning reads.

You would see the following for positive strand:

CATCACTGGTTTAAAGACAAACTTGCATTGTGAGATTCCAAAATAACAACAACAAAAAACAATTTGCATTGAGAACATTTTGAAG

.........A.......
.....>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
.....>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

You would see for negative strand.

TTTCATTTGCAAGTAATCGATTTAGGTTTTTGATTTTAGGGTTTTTTTTTGTTTTGAACAGTCCAGTCAAAGTACAAATCGAGAG
...KK....KKK..KK.K.K...K........K....K..................KKKK.........K...K...........
<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<,,,,,,,,t,,,c,,,,,,,,,,
ADD COMMENT
0
Entering edit mode

The strand info comes from the aligner. Aligner get input from genome.fasta file to build index, meanwhile the genome.fasta file is recorded in 5'->3' direction. Thus if the read matches the raw genome.fasta sequence, the read is considered mapped on the positive strand, and vice versa. I hope so.

ADD REPLY

Login before adding your answer.

Traffic: 1907 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6