Question: Cutadapt 5' adapter
0
gravatar for ashwini
4.2 years ago by
ashwini90
India
ashwini90 wrote:

Hi,

I am using cutadapt to trim small RNA reads.

The following is the command used-

cutadapt -a TGGAATTCTCGGGTGCCAAGG -g TTCAGAGTTCTACAGTCCGACGATC -m 15 -M 51 --untrimmed-output=FILE_NAME IN.fastq > OUT.fastq

I have changed "U" in the actual adapter to "T" while using with -g option (RA5) and have found few reads with this adapter. Am I right in doing this?

The 5'  and 3' adapters are ( http://supportres.illumina.com/documents/documentation/chemistry_documentation/experiment-design/illumina-customer-sequence-letter.pdf )

RNA 5’ Adapter (RA5), part # 15013205
5’ GUUCAGAGUUCUACAGUCCGACGAUC

RNA 3’ Adapter (RA3), part # 15013207
5’ TGGAATTCTCGGGTGCCAAGG

 

 

 

cutadapt 5' adapter smallrna • 1.9k views
ADD COMMENTlink modified 4.2 years ago by Fabio Marroni2.2k • written 4.2 years ago by ashwini90
0
gravatar for Fabio Marroni
4.2 years ago by
Fabio Marroni2.2k
Italy
Fabio Marroni2.2k wrote:

Yes, you are right.

Since you are actually sequencing cDNA, you will have T and not U.

 

 

ADD COMMENTlink written 4.2 years ago by Fabio Marroni2.2k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1474 users visited in the last hour