Cutadapt 5' adapter
1
0
Entering edit mode
6.6 years ago
ashwini ▴ 100

Hi,

I am using cutadapt to trim small RNA reads.

The following is the command used-

cutadapt -a TGGAATTCTCGGGTGCCAAGG -g TTCAGAGTTCTACAGTCCGACGATC -m 15 -M 51 --untrimmed-output=FILE_NAME IN.fastq > OUT.fastq

I have changed "U" in the actual adapter to "T" while using with -g option (RA5) and have found few reads with this adapter. Am I right in doing this?

The 5'  and 3' adapters are ( http://supportres.illumina.com/documents/documentation/chemistry_documentation/experiment-design/illumina-customer-sequence-letter.pdf )

RNA 5’ Adapter (RA5), part # 15013205
5’ GUUCAGAGUUCUACAGUCCGACGAUC

RNA 3’ Adapter (RA3), part # 15013207
5’ TGGAATTCTCGGGTGCCAAGG

 

 

 

smallRNA cutadapt 5' adapter • 2.7k views
ADD COMMENT
0
Entering edit mode
6.6 years ago
Fabio Marroni ★ 2.8k

Yes, you are right.

Since you are actually sequencing cDNA, you will have T and not U.

 

 

ADD COMMENT

Login before adding your answer.

Traffic: 1013 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6