Cutadapt 5' adapter
Entering edit mode
7.7 years ago
ashwini ▴ 100


I am using cutadapt to trim small RNA reads.

The following is the command used -

cutadapt -a TGGAATTCTCGGGTGCCAAGG -g TTCAGAGTTCTACAGTCCGACGATC -m 15 -M 51 --untrimmed-output=FILE_NAME IN.fastq > OUT.fastq

I have changed "U" in the actual adapter to "T" while using with -g option (RA5) and have found few reads with this adapter. Am I right in doing this?

The 5' and 3' adapters are

RNA 5' Adapter (RA5), part # 15013205

RNA 3' Adapter (RA3), part # 15013207
smallRNA cutadapt 5-prime-adapter • 3.1k views
Entering edit mode
7.7 years ago
Fabio Marroni ★ 2.9k

Yes, you are right.

Since you are actually sequencing cDNA, you will have T and not U.


Login before adding your answer.

Traffic: 2003 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6