Entering edit mode
10.5 years ago
win
▴
990
Hi all,
I am trying to align a fastq file from the solexa platform using the Isaac Aligner and I get the following error after a few minutes of processing.
[7f5e2c47d780] FastqFlowcellInfo(2,119:0,[1 ])
2015-03-20 16:48:35 [7f5e2c47d780] use bases mask: yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyn
2015-03-20 16:48:35 [7f5e2c47d780] reads parsed: 1
2015-03-20 16:48:35 [7f5e2c47d780] Discovered data read: ReadMetadata(1, 118 [1, 118], 0id, 0off,1frc)
2015-03-20 16:48:35 [7f5e2c47d780] constructed extremity seed SeedMetadata(0, 32, 0, 0)
2015-03-20 16:48:35 [7f5e2c47d780] constructed extremity seed SeedMetadata(86, 32, 0, 1)
2015-03-20 16:48:35 [7f5e2c47d780] constructed SeedMetadata(32, 32, 0, 2)
2015-03-20 16:48:35 [7f5e2c47d780] constructed overlapping SeedMetadata(16, 32, 0, 3)
2015-03-20 16:48:35 [7f5e2c47d780] Generated 'none' barcode: BarcodeMetadata(2,1,default,none,(o), 4294967295)
2015-03-20 16:48:35 [7f5e2c47d780] align: Setting memory limit to 42949672960 bytes.
2015-03-20 16:48:35 [7f5e2c47d780] Aligner: adding base-calls path "/datadrive/isaacDenisovan"
2015-03-20 16:48:35 [7f5e2c47d780] Determining memory capacity for Fastq data
2015-03-20 16:48:35 [7f5e2c47d780] Determining memory capacity for Fastq data done. 223980279 clusters of length 118 will fit
2015-03-20 16:49:45 [7f5e2c47d780] Opened fastq stream on /datadrive/isaacDenisovan/lane1_read1.fastq
Error: 2015-Mar-20 16:49:47: Invalid argument: /home/peterz/isaacAlnSrc/isaac_aligner-master/src/c++/include/io/FastqReader.hh(194): Throw in function InsertIt isaac::io::FastqReader::extractBcl(const isaac::flowcell::ReadMetadata&, InsertIt) const [with InsertIt = __gnu_cxx::__normal_iterator<char*, std::vector<char> >]
Dynamic exception type: boost::exception_detail::clone_impl<isaac::common::IoException>
std::exception::what: Read length (99) is different from expected 118 in /datadrive/isaacDenisovan/lane1_read1.fastq:294. Record @M_SOLEXA-GA03_PEi_JK_3004_5:5:4:12109:5782#GTCGACT
GTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGAGATCGGAAGAGCA
+
B@I(KFNMQBLO+QPIHNLPTCNQJRUOKPSVU'U\QZ\QYWY][YX]WV]W\]W]]U]\X[\V][Z]]&Y]R][W]ZUV[V[XU&-T&*YO-NI+R&P
: Read length (99) is different from expected 118 in /datadrive/isaacDenisovan/lane1_read1.fastq:294. Record @M_SOLEXA-GA03_PEi_JK_3004_5:5:4:12109:5782#GTCGACT
GTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGAGATCGGAAGAGCA
+
B@I(KFNMQBLO+QPIHNLPTCNQJRUOKPSVU'U\QZ\QYWY][YX]WV]W\]W]]U]\X[\V][Z]]&Y]R][W]ZUV[V[XU&-T&*YO-NI+R&P
Any ideas what this could mean? Thanks in advance.
where to make that setting change.