Question: Why sequence is unmapped by bwa but position is given in Sam file and also can be aligned by blat ?
1
gravatar for ZheFrench
4.0 years ago by
ZheFrench210
France
ZheFrench210 wrote:

I have a read where sam flag is 69 (meaning Pair End Read, Unmapped and First in Pair) , Mapping quality is 0 and Cigar string is *. The sequence is not showed in the viewer (samtool tiview,IGV).

I'm wondering why a read is said unmapped whereas a position is given in the sam file. So the read can be mapped ?When i tried to align with blat , i found one unique position (the same as in sam file) . 

So i don't understand ...Why this read is said unmapped whereas a position is given(chr12 112036669) ? How to retrieve/use this read in my bam to display in viewer as a "good sequence"? Why is the read filtered ? Because of the mapping quality ? and why CIGAR string is set to *. Can i use it of one way or an another or is it a better idea to let this read stay in "garbage" ? Thanks.

M02792:15:000000000-A98VA:1:1103:24705:18436 69 chr12 112036669 0 * = 112036669 0 GTCGCTGAAGCCCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCGCCGCCCGCGG CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG8FGGG@FF:F@FE=: RG:Z:A421

sequence alignment • 2.3k views
ADD COMMENTlink modified 14 months ago by hoxus.bidon10 • written 4.0 years ago by ZheFrench210
2
gravatar for Devon Ryan
4.0 years ago by
Devon Ryan89k
Freiburg, Germany
Devon Ryan89k wrote:

If an alignment is marked as unmapped then any position information is unreliable, since it may simply be a hold-over from an internal method that didn't get cleared. In the case of paired-end reads like this, typically an unmapped mate is given the coordinates of its mapped mate.

ADD COMMENTlink modified 4.0 years ago • written 4.0 years ago by Devon Ryan89k

Ok so that's meaning the sequence is unmapped for X reasons but the sequence can be still considered as a "good one". If I use another mapper or bwa with different parameters for example, the sequence could be probably set as mapped. The mapping is wrong but the sequence is (probably) good ?

ADD REPLYlink written 4.0 years ago by ZheFrench210
3

The sequence is simply the sequence. Whether a read maps or not has no bearing on the quality of its sequence.

ADD REPLYlink written 4.0 years ago by Devon Ryan89k
1
gravatar for hoxus.bidon
14 months ago by
hoxus.bidon10
hoxus.bidon10 wrote:

Long time ago, but I have the same "problem".

Read in the BWA FAQ:

I see a read stands out the end of a chromosome and is flagged as unmapped (flag 0x4). What is happening here? Internally BWA concatenates all reference sequences into one long sequence. A read may be mapped to the junction of two adjacent reference sequences. In this case, BWA will flag the read as unmapped, but you will see position, CIGAR and all the tags. A better solution would be to choose an alternative position or trim the alignment out of the end, but this is quite complicated in programming and is not implemented at the moment.

ADD COMMENTlink written 14 months ago by hoxus.bidon10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 645 users visited in the last hour