Question: Why does BWA give different Mapping Quality to identical reads?
3
gravatar for Asdp
5.6 years ago by
Asdp40
France
Asdp40 wrote:

Hi Biostars,

Below are two paired-end reads in sam format. The forward of the first and the forward of the second have the same start position and the same sequence. The first paired-end read has a mapping quality of 0 and the second has a mapping quality of 9. Zero mapping quality indicates that the read maps to multiple locations. But, in this case, the sequences are the same.
Why do these reads have different Mapping Quality? Thanks for your help!

HWI-1KL149:88:C41FMACXX:4:2208:12488:52749      163     1       155581760       0       100M    =       155581788       128     TTTACTTGTGGCAGGGAAGCAGGTCGGCTGGAGGCTTTTGGCCAAGGGGAAAGTGTCCTAAAGGAACCCAAGTACCAGGAAGAGCTGGAGGACAGGCTGC       CB@CEHAEDFDCFFCCBCEEEECDE?DDFGDDBDDEDCDCDCD?DEDDDE?FF;2BIDIEEGDC<DBIIIGAC>I7AHHEGAGGJ"9>DBHFDJHGFACA    XA:Z:1,+155717340,100M,0;  MC:Z:100M       BD:Z:NNFNRQNPMMPOPPOKNMNOOPONPONOOPPOOPOOMEEOPOOPNOQLMPOEPQNNQPPONEPQPOOPLQOPQPPPQRQPOPPQRQRRQQRRSPTTPPQQ       MD:Z:100        PG:Z:MarkDuplicates     RG:Z:p26   BI:Z:IIGKRQONMLLLJID?HHLKEGIKNJJNMOLMNKGB?=ADFHHLKJD<<EECCCGHMMMQOJKJMNQOMPPQPQPMNPNOPQPPOLKDBDFINPQOHGIK       NM:i:0  MQ:i:0  AS:i:100        XS:i:100
HWI-1KL149:88:C41FMACXX:4:2208:12488:52749      83      1       155581788       0       100M    =       155581760       -128    TGCAGGCTTTTGGCCAAGGGGATAGTGTCCTAAAGGAACCCAAGTACCAGGAAGAGCTGGAGGACAGGCTGCATTTCTACGTGGAGGAATGTGACTACTT       ###EGGHE<9JK?EGIJHF>@="JGHGEEFEEEGEGEEEEHEFFEEDGFDFDFFFFFFDFFDFDGFDEFFDGEDDDFDDAEFDFFDFDGGGFHHGED>DA    XA:Z:1,-155717368,100M,2;  MC:Z:100M       BD:Z:NNNPQSRGGPRQQRQNPLLPQOOPNNQPQPNFNPPOOPMQPNPPPPQQPOOMNNOPQPONOOPMPOOPQPPPNDNOOOONMPONOONOQNNQRRRRQPNN       MD:Z:2G19A77    PG:Z:MarkDuplicates     RG:Z:p26   BI:Z:IIIHIOPNNPPNONPPONNORRQPPMKHCEKKNNNQOOIIFA@>>CFLMNQONNLPPONONNPOONMPPLOOMJMPPPLMQONNMMPOPPQOPOPQIJII       NM:i:2  MQ:i:0  AS:i:92 XS:i:92

HWI-1KL149:88:C41FMACXX:4:1215:3187:9272        99      1       155581760       9       100M    =       155581855       195     TTTACTTGTGGCAGGGAAGCAGGTCGGCTGGAGGCTTTTGGCCAAGGGGAAAGTGTCCTAAAGGAACCCAAGTACCAGGAAGAGCTGGAGGACAGGCTGC       CC@DFJHF6DEGF?DD9C>8B@CBE7@DDED?ADEEDDDCAECEDBAADDEF??;<>GHEGGCCBBCIJECA>?DIIC=C@IGIKK?=B:67AG8?AB<=    XA:Z:1,+155717340,100M,0;  MC:Z:100M       BD:Z:NNFNRROQONQPQQPLONOPPQPOPONOOPPOOPOOMEEOPOOPNOPLLPNEPQNNQPPONEPQPOOPLQOPQPPPQRQPOPPPQQRRQQRRSPTRPPQQ       MD:Z:100        PG:Z:MarkDuplicates     RG:Z:p24   BI:Z:IIGKRPOOOOMNLOMJNOPPMPNOPIHKKMLOPNNMOMMOMNMOOOMJKOOLMHC==>@HLKPNOOQNKIDEHKNNOPOPPQQQQNPNPQOPQPOJHGIK       NM:i:0  MQ:i:9  AS:i:100        XS:i:100
HWI-1KL149:88:C41FMACXX:4:1215:3187:9272        147     1       155581855       9       100M    =       155581760       -195    GCTGCATTTCTACGTGGAGGAATGTGACTACTTGCAGGTAGTGGCGTGGCAATGTGCACTCCAGGGTGGAAGCTCTTCTCATCCTGCTAACTATCTTTTG       FCBCGHHHHHCHEJJHIJJIICHGBDFGFDFGGGCDFFDEFFDE@AFBDFBDFFED?AFDDGEDDFADFDED=??ACD@FDC?EEEBE8=B7FA@ED?C@    XA:Z:1,-155717435,100M,1;  MC:Z:100M       BD:Z:QRQQTQGQRQQQPORQPPPOOQNNPQQPPQPOQQQPPPOPNQPOONQPQPOQMNPPMPOOPPOKOMPONMOPOOONNNOONNOPOONMNPONPPQGEONN       MD:Z:100        PG:Z:MarkDuplicates     RG:Z:p24   BI:Z:JJGKRQMMJHD?DMNMONORPPPPMOPQQPQOMQNLKLNOQNLJFIC@GEFAAGGMLJJHBC>=DJLLONMPPOOMLKGIKKGIAFINMNMOOPQNGIII       NM:i:0  MQ:i:9  AS:i:100        XS:i:98
bwa mapping quality alignment • 2.0k views
ADD COMMENTlink modified 5.6 years ago by matted7.3k • written 5.6 years ago by Asdp40
1
"...POOPOOMEEOPOOPNO..."

I'm guessing this is a fecal microbiome...?

ADD REPLYlink written 5.6 years ago by Brian Bushnell17k

Seems you have been doing a lot of metagenomics lately :-)

ADD REPLYlink written 5.6 years ago by Ashutosh Pandey12k

May be you pasted the wrong read. I can't see read with MAPQ of 9. 

ADD REPLYlink written 5.6 years ago by Ashutosh Pandey12k

Fixed. Thanks.

ADD REPLYlink written 5.6 years ago by Asdp40
2
gravatar for matted
5.6 years ago by
matted7.3k
Boston, United States
matted7.3k wrote:

The other reads in the pairs map to different locations (155581788 vs 155581855), and that affects the mapping quality since pairs are evaluated together in bwa (see e.g. http://genome.sph.umich.edu/wiki/Mapping_Quality_Scores).

ADD COMMENTlink modified 5.6 years ago • written 5.6 years ago by matted7.3k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1010 users visited in the last hour