Black color reads in IGV: bwa-meth
Entering edit mode
9.1 years ago

Using bwa-meth for whole genome bisulfite sequencing, I found that reads are shown in black.

Same file analyzed by Bismark, has grey colour reads az expected.

Example of reads:

BWA-meth file Ex_1:


Bismark-bowtie2 Ex_2:

HWI-ST762:353:C5PD6ACXX:4:2102:15861:95520/1    163     chr1    10005   42      99M     =       10059   105     CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT     BBBFFFFFFFBFBFFFFIIFBFFFIIIF<FBFFFIFFFBFBBFFFFFFFIIBF<FB<<BF0B'77BBF<77<BB<BBBBB<B<7<<77B7<B7BBB7B<  MD:Z:99 PG:Z:MarkDuplicates.2   XG:Z:GA NM:i:0  XM:Z:...................................................................................................    XR:Z:GA

The only difference I noticed is the fact that pair information is not available in bwa-meth output. However as you see in the screenshot, IGV is able to find reads. I would appreciate any input on what might be the reason.

Many thanks


IGV alignment bwa-meth • 4.3k views
Entering edit mode

The pairing information is there in both, but the methylation call string isn't there for bwa-meth (it doesn't produce it). Perhaps that's the reason IGV is treating the alignments differently.

Entering edit mode

You are right. I got this from Jim Robinson IGV mailing list:

This is caused by the "YC" tag, which igv interprets as an explicit color setting. This is a common use of this tag, not in the spec as Y is user-defined but a common long-standing convention that IGV supports. In this case it tries to convert "GA" to a color and fails so black is used."


Entering edit mode

good to know

Entering edit mode

Is the YC tag used by other tools downstream? Can it be changed to another tag with no consequences?


Login before adding your answer.

Traffic: 3111 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6