Question: bam file flags- interpretation
0
gravatar for krp0001
5.3 years ago by
krp000130
Sweden
krp000130 wrote:

 

Dear Users, 

Recently i have aligned my illumina reads to my reference genome. I have gone through sam file specifications but, it is quiet difficult to understand. 

It would be great help if some one could explain the bam flags below.

few line of my aligned bam file.

HISEQ:115:C49JYACXX:4:1114:10901:17520  163     scaffold1       1       7       4M2I94M =       208     307     GCACAGAACTTTTTATTGAACAATTGGGCTACTAAATATGCTTACCAAACTCTATGGTAGTGTAGTCACAGTCTCTTAGTAGTAGTATCGATATATTGTA    CC@FFFFFFHHHHJJJJIJJJIJJJIJJJGJIJIIJIJIIIJIJJGIJIIHIIJJJJFHIGHGBHCGIJIJIJJJGIJJCEHHHHHHFFFFDDDEFEEEE    AS:i:-21        XS:i:0  XN:i:0  XM:i:2  XO:i:1  XG:i:2  NM:i:4  MD:Z:0A2G94     YS:i:-11        YT:Z:CP

Thank you

 

assembly • 4.0k views
ADD COMMENTlink modified 2.9 years ago by Simply Bioinformatics170 • written 5.3 years ago by krp000130
1

Flags are explained here
A: How To Filter Mapped Reads With Samtools

ADD REPLYlink written 5.3 years ago by Sukhdeep Singh10k
2
gravatar for Zev.Kronenberg
5.3 years ago by
United States
Zev.Kronenberg11k wrote:

There is a neat app to explain the SAM flags: http://broadinstitute.github.io/picard/explain-flags.html

ADD COMMENTlink modified 11 months ago by RamRS30k • written 5.3 years ago by Zev.Kronenberg11k

Thats worth the effort!

ADD REPLYlink written 5.3 years ago by Sukhdeep Singh10k

Thank you Zev, for your quick reply..!

ADD REPLYlink written 5.3 years ago by krp000130
0
gravatar for Simply Bioinformatics
2.9 years ago by
WashingtonDC
Simply Bioinformatics170 wrote:

Four Main reference Sites that You might need during your adventure:

ENJOY ;)

1) https://broadinstitute.github.io/picard/explain-flags.html

2)http://www.samformat.info/sam-format-flag

3)http://www.samformat.info/sam-format-flag-single

4)https://ppotato.wordpress.com/2010/08/25/samtool-bitwise-flag-paired-reads/

ADD COMMENTlink written 2.9 years ago by Simply Bioinformatics170
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2318 users visited in the last hour