Trimming adapter sequence for NEBNext kit
2
3
Entering edit mode
6.2 years ago
sitinorani ▴ 30

Hi, 

I have RNA-seq raw reads from HiSeq2000. I prepared the library using NEBNext ultra directional kit for illumina. I want to do trimming of adapter, however I am not sure which adapter sequence I need to use to trim the data. Does anyone know the adapter sequence for this NEB kit?

Thank you.

rna-seq • 17k views
ADD COMMENT
7
Entering edit mode
4.7 years ago

Hello!

Adapter trimming is necessary for down-stream analysis. This is because: if your insert size is smaller than sequencing cycles, adapter, which is next to the insert, will be sequenced. And this is what your want to removed from your raw data.

Here is my situation, and hope this helps:

  1. Sequencing platform: HiSeq 3000, paired-end (2 X 150bp)
  2. Kit used for library construction: NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 & 2)
  3. Cutadapt was used for adapter trimming, and here is the script: (http://cutadapt.readthedocs.io/en/stable/guide.html#illumina-truseq)

        -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \ # remove adapter from Read1
        -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT \ # remove adapter from Read2
        -o trimmed.1.fastq.gz -p trimmed.2.fastq.gz \
        reads.1.fastq.gz reads.2.fastq.gz
    

The adapter sequences used in the script above are portions of "index primer" and "universal primer" sequence from NEBNext kit, respectively (as you will find, they are the complementary sequences from 3' to 5'). And this has been nicely addressed by Lesley Sitter.

  • NEBNext Universal PCR Primer sequence:
    5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
  • NEBNext Index Primers (1-3 for example, indexes are in parentheses):
    Index 1 5'-CAAGCAGAAGACGGCATACGAGAT(CGTGAT)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3'
    Index 2 5'-CAAGCAGAAGACGGCATACGAGAT(ACATCG)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3'
    Index 3 5'-CAAGCAGAAGACGGCATACGAGAT(GCCTAA)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3'

Lastly, here is a figure that might be helpful. As I said in the beginning: if insert size is smaller than sequencing cycles, adapter will be sequenced.

enter image description here

ADD COMMENT
3
Entering edit mode
6.2 years ago
Lesley Sitter ▴ 560

Hi,

I'm not familiar with the NEB kit itself but if found a possible adapter sequence for trimming.

In the NEBkit manual page 5 it states that the adapter is

5'-/5Phos/GAT CGG AAG AGC ACA CGT CTG AAC TCC AGT C/ideoxyU/A CAC TCT TTC CCT ACA CGA CGC TCT TCC GAT C*T-3'

https://www.neb.com/~/media/Catalog/All-Products/33E45F5CD69B497E92C1073F5D551DC7/Datacards%20or%20Manuals/manualE7335.pdf

On this page;

They discuss what type of adapters they use for trimming when using the NEBNext lib prep kit. It seems you also have some sort of index (I'm unfamiliar with the NEBNext protocol, sorry)? In any case these are the adapter sequences they used for trimming;

NEBnext Universal primer
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T

NEBnext Indexed primers 1 - 12 (6-mer indexes)

Index 1 CAAGCAGAAGACGGCATACGAGAT***CGTGAT***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Index 2 CAAGCAGAAGACGGCATACGAGAT***ACATCG***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Index 3 CAAGCAGAAGACGGCATACGAGAT***GCCTAA***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Index 4 CAAGCAGAAGACGGCATACGAGAT***TGGTCA***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Index 5 CAAGCAGAAGACGGCATACGAGAT***CACTGT***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Index 6 CAAGCAGAAGACGGCATACGAGAT***ATTGGC***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Index 7 CAAGCAGAAGACGGCATACGAGAT***GATCTG***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Index 8 CAAGCAGAAGACGGCATACGAGAT***TCAAGT***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Index 9 CAAGCAGAAGACGGCATACGAGAT***CTGATC***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Index 10 CAAGCAGAAGACGGCATACGAGAT***AAGCTA***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Index 11 CAAGCAGAAGACGGCATACGAGAT***GTAGCC***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Index 12 CAAGCAGAAGACGGCATACGAGAT***TACAAG***GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
ADD COMMENT
0
Entering edit mode

Thank you so much!

Should I used universal adapter only or all the index primer?

ADD REPLY
1
Entering edit mode

Like I said I don't know the protocol so I don't know what the index does. Maybe ask your lab technician what he did and then use the appropriate sequence for trimming.

In my honest opinion I don't think it will matter either way if you add all of them to the trimmer or only use one or the other, they look long enough for trimmers to only cut them specifically and not remove unwanted read bases, but that is just an opinion, not hard evidence :P

ADD REPLY
0
Entering edit mode

Btw, Thank you for your suggestion :)

ADD REPLY

Login before adding your answer.

Traffic: 2372 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6