We've run into an interesting problem with SOAPaligner 2.21, it seems to replace all Ns in query reads by Gs, has anyone ever seen this?
Here's a simple test, first the reference:
>First
ATCGTCGATCGATCATCATCGATGCGAGCTAGCTAGCTACTAGCAT
ATCGTCGATCGATCATCATCGATGCTAGCTAGCTAGCTACTAGCAT
GTCAGTCGATGCATGCTAGCTGATCGATCGATGCTAGTCAGTCAGC
GCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTGACTAGCTAGCTAGT
GCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTGACTAGCTAGCTAGT
The first read:
@First/1
ATCGTCGATCGATCATCATCGATGNNAGCTAGCTAGCTACTAGCAT
# ----------------------^^
# comment lines added to highlight Ns
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
As you can see, two Ns. The second read:
@First/2
GCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTGACTAGCTAGCTAGT
+
##############################################
No Ns, just as a test.
Running soap:
soap -a first.fastq -b second.fastq -D reference.fasta.index -o paired.soap -2 unpaired.soap -u unmapped.soap -m 0 -x 1000
Total Pairs: 1 PE
Paired: 0 ( 0.00%) PE
Singled: 2 (100.00%) SE
And the output:
First/1 ATCGTCGATCGATCATCATCGATGGGAGCTAGCTAGCTACTAGCAT BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB 2 a 46 + First 47 2 C->24G2 T->25G2 46M 24CT20
First/2 GCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTGACTAGCTAGCTAGT ############################################## 6 b 46 + First 323 0 46M 46
As you can see, it aligns the read 'First/1' to the second line in the reference. There are two differences between the reference and the read in bold - here soap says that the reference's C differs from a G in the read, and a T differs from the read's G. But where do these Gs come from? The read has Ns there!
We've played around a bit with it and it seems to silently replace Ns with Gs everywhere, has anyone else seen this before? We're a bit concerned this might accidentally introduce G SNPs.
this is one of those things where you say to yourself: nah that can't be true,
but then it is bioinformatics where everything is possible and the points don't matter
Hahahah xD
SOAPdenovo, all readears please spread the word, people need to know about this.
If you carefully look the SOAPaligner usage, you will find out that the reason of this replacement is the
-noption:So the default value for Ns is 5. You can set it to 0 or whatever you want.
As for the N to G replacement, I think that it could cause some problems, if you are carrying and using the transformed mapped read sequence in the next steps of your analysis. Otherwise, you shouldn't be concerned for the actual mapping of such reads , as the
-n Ns are just ignored ( and replaced with Gs as you observed! ).Did you determine how widespread this is and if there was a fix? A little worried to see this now, 20 months later!
I've sent an email to them but since it's not really developed I never heard back. Most SNP calling pipelines should remove this SNP as the base quality to call it is usually the worst possible, but it doesn't hurt to check!