Batch replcement of fasta header

Question

[mbk0asis]

Hello

I'm trying to add some texts next to the existing fasta headers.

The fasta file contains 100 mRNA sequences, and additional information are saved in a separate file.

Input 1:

>NM_001133328
ggccattacggccggggctcccgctcgccctgaacctagtacctgcagccatg

Input 2:

NM_001133328    chr2b    +    107030810    107070838    ATIC

Output;
>NM_001133328    chr2b    +    107030810    107070838    ATIC
ggccattacggccggggctcccgctcgccctgaacctagtacctgcagccatg

I tried using 'awk' and 'while' commands, but couldn't figure it out.

Here's the command:

cat Input2 | while read line; do awk '/^>/ {$0=$0 "'$line'"}1' Input1 ; done | head

and the error message

awk: cmd. line:1:             ^ unterminated string
awk: cmd. line:1: /^>/ {$0=$0 " NM_001168566
awk: cmd. line:1:             ^ syntax error

Can anyone help me?

Thank you!

Answer 1

[Sam]

awk can handle two file at once:

awk -v arrayStore -v fastaLine=1 'FNR==NR {arrayStore[NR] = $1;} FNR!=NR{if($1~/^>/){ print $0" "arrayStore[fastaLine]; fastaLine=fastaLine+1;}else{print}' Input2 Input1 > output

You can also use hash mapping which should be similar