Question: Calculation of CpG ratio within X nucleotides
0
gravatar for thefirstrealace
4.9 years ago by
Germany
thefirstrealace30 wrote:

Hello again,

i need to calculate the CpG ratio within certain DNA sequences in order to correlate them with several properties and for different other reasons. Can somebody explain me how this is done for the following artificial example sequence?


ATGCGTGCAGTGATCGCGATTTA


As far as i understand, the GC-basepair ratio is the number of C's + G's divided by the length of the above sequence. In the example we have:

  • Seq-length:        23
  • Number of C's:   4
  • Number of G's:   7

If the definition i found for GC content is correct, then in the above example the GC content would be:

  • (4+7) / 23 = 47,83% (rounded value).

How is the CpG ratio defined? I am not searching for CpG islands.

 

Best regards

cpg • 2.0k views
ADD COMMENTlink modified 4.9 years ago by Devon Ryan97k • written 4.9 years ago by thefirstrealace30
2
gravatar for Devon Ryan
4.9 years ago by
Devon Ryan97k
Freiburg, Germany
Devon Ryan97k wrote:

For this, only need to know what a CpG is. You would want the percentage of bases in CpGs.

ADD COMMENTlink written 4.9 years ago by Devon Ryan97k

So for the above example:

ATGCGTGCAGTGATCGCGATTTA
___^^_________^^^^

would it be 6/23 bases --> 26,08%?

Best regards

ADD REPLYlink modified 11 months ago by _r_am31k • written 4.9 years ago by thefirstrealace30

correct

ADD REPLYlink modified 11 months ago by _r_am31k • written 4.9 years ago by Devon Ryan97k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2076 users visited in the last hour