Question: subset fasta file sequences with id's file
gravatar for andreiareis1987
3.1 years ago by
andreiareis198730 wrote:

I have been stuck with some script!

Well i made this script in 2008 and now i am using with some modifications and i get error!

#!/usr/bin/perl -w

use strict;
use Data::Dumper;

sub getSequences ($) {

    my $file = $_[0];
    open (INFILE, "<$file") || die "Error1 in opening in file: $file. $!\n";

        my @lines = <INFILE>;
        my $header; my %header2seq = ();

        foreach my $line (@lines) {
            chomp $line;
            if ($line =~ /^(>.+)$/o) {
                $header = $1;
            else {$header2seq {$header} .= $line; }
#print %header2seq;
    close (INFILE);
    return (\%header2seq);

sub MakeSpList ($) {

    my $sp_list = $_[0]; my %sp_names = ();
    open (INFILE2, "<$sp_list") || die "Error2 in opening in file: $sp_list. $!\n";
    my @sps = <INFILE2>;
    foreach my $line (@sps) { chomp $line; $sp_names {$line} = 1; }
    close (INFILE2);
#print Dumper (%sp_names);
    return (\%sp_names);

sub CompareSpList2Sequences ($$$) {
     my $ref_header2seq = $_[0] ; my $ref_sp_names = $_[1]; my $file = $_[2];
     open (OUTFILE, ">$file.subdata") || die ("Error3 in opening out file: $file.subdata. $!\n");
     foreach my $key (keys %$ref_header2seq) {
         $key =~ m/^>([A-Z]+[0-9]+[A-Z+]).+$/o;
        #print "$1\n";
          my $header_sub = $1;
         #print $header_sub, "\n";
         #print $ref_sp_names, "\n";
         if (exists $ref_sp_names -> {$header_sub}) {
             my $seq = $ref_header2seq -> {$key};
             print OUTFILE ">$key\n$seq\n";
     close (OUTFILE);
     return "42";

my $fasta_seqs = $ARGV[0]; my $sp_list = $ARGV[1];

my $ref_header2seq = getSequences ($fasta_seqs);
my $ref_sp_names = MakeSpList ($sp_list);
CompareSpList2Sequences ($ref_header2seq , $ref_sp_names, $fasta_seqs);



What i want to do is:

i have a fasta file with sequences:


>YAL005C SSA1 SGDID:S000000004, Chr I from 141431-139503, Genome Release 64-2-1, reverse complement, Verified ORF, "ATPase involved in protein folding and NLS-directed nuclear transport; member of HSP70 family; forms chaperone complex with Ydj1p; localized to nucleus, cytoplasm, and cell wall; 98% identical with paralog Ssa2p, but subtle differences between the two proteins provide functional specificity with respect to propagation of yeast [URE3] prions and vacuolar-mediated degradations of gluconeogenesis enzymes; general targeting factor of Hsp104p to prion fibrils" ATGTCAAAAGCTGTCGGTATTGATTTAGGTACAACATACTCGTGTGTTGCTCACTTTGCTAATGATCGTGTGGACATTATTGCCAACGATCAAGGTAACAGAACCACTCCATCTTTTGTCGCTTTCACTGACACTGAAAGATTGATTGGTGATGCTGCTAAGAATCAAGCTGCTATGAATCCTTCGAATACCGTTTTCGACGCTAAGCGTTTGATCGGTAGAAACTTCAAC

and i have another file with ID's:



I want to retrieve the sequences and the all header when match with ID's file.

but i get error: don't print nothing!

Please can you help me?

Thanks in advance.

  • i already searched for other methods (and i can´t get the results either) but i really want to know about this error!
  • no bioperl please!


id's sequence fasta perl • 1.6k views
ADD COMMENTlink modified 3.1 years ago by Matt Shirley8.9k • written 3.1 years ago by andreiareis198730
gravatar for Matt Shirley
3.1 years ago by
Matt Shirley8.9k
Cambridge, MA
Matt Shirley8.9k wrote:

You can use pyfaidx for this:

$ pip install pyfaidx
$ xargs faidx seqs.fasta --full-names < ids.txt

The --full-names argument will retrieve the entire header for each sequence, and by default the sequence entries are constructed by throwing away anything after the first whitespace in the header, so your ids.txt file can just look like:

ADD COMMENTlink modified 3.1 years ago • written 3.1 years ago by Matt Shirley8.9k
gravatar for ericfournier3
3.1 years ago by
ericfournier330 wrote:

You can use seqtk  ( ) to filter a fasta file by ID. It will be a lot easier than trying to reinvent the wheel.

ADD COMMENTlink written 3.1 years ago by ericfournier330
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 766 users visited in the last hour