Multiple alignment format (MAF) to VCF
0
0
Entering edit mode
7.9 years ago
ksw ▴ 40

Hi,

I am wondering the best way to convert a Multiple Alignment Format file (MAF) generated with Mugsy (http://mugsy.sourceforge.net/) into a VCF format for downstream analysis?

I have looked through past posts and haven't found an answer. It seems that there was an earlier branch of Biopython which could do this but I don't think it is being updated.

If anyone has suggestions, that would be incredible! Thank you!

MAF VCF • 5.3k views
ADD COMMENT
0
Entering edit mode

Did the past posts include this one: converting maf to vcf There is a script linked in that post that is still available to try.

ADD REPLY
0
Entering edit mode

Thanks for your reply. Yes, I looked at the script you posted--it converts files in Mutation Annotation Format (another MAF file, specific to cancer genotyping, I think) to VCF format. The MAF format I am struggling with is Multiple Alignment Format.

ADD REPLY
1
Entering edit mode

A different MAF. What does you file look like (can you show a few lines)? Perhaps this may help: Getting A Vcf File From A Fasta Alignment

ADD REPLY
0
Entering edit mode

Thanks, I'll look into the script you posted. The first lines of the MAF:

##maf version=1 scoring=mugsy a score=640492 label=1 mult=3 s B31.Chromosome 4603 638466 + 910724 AAAATCTCAGGAGAGGGATCAAATGGGGGATGCATAATTCATCCTTCAAGGGTAAGAGACCCAATTACTACTTTACTTAGTATCGTAAAATTATTAAAAATGAAAGAACTTTACCAAATATGGTGTAAATTGTCTAAAAACCACTATAAAGAAAAGTACGACTTAAAAGATATTTTAAATACAACAAATTTTTATAGTAATGTAATAGTATCATCCAAAAAAGCCAATTTAACAAATCTAAAAATAGAAAATCAAGAAATTTTAAAAAGCAATTATGAAAATCTATTGATTAAAGAGATAAAAAGTAATAAGTTATTTCAAGAATTATCAGTAGTTGATTATGAAATCATTAACTATGAAGGCAAAAGACAATCTAAGATTAGAACAGGAGATTCTTCGGGAGGATTAAAGGTATTGT

ADD REPLY
1
Entering edit mode

To update this thread: my issue was that I have called variants using short read data (i.e. generating BAM, then VCF files with respect to a reference genome). I am now interested in including outgroup (FASTA) sequences and need to call variants between the outgroups and the FASTA reference genome. The following tool takes a multiple FASTA alignment (for me, my reference genome and outgroup genomes) and can generate a VCF file:

[https://github.com/sanger-pathogens/snp-sites]

Thanks for your help!

ADD REPLY

Login before adding your answer.

Traffic: 1900 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6