Entering edit mode
9.4 years ago
chen
★
2.5k
Blast results usually give Homo sapiens BAC clone.
For example, following is a sequence from EML4:
AGGTAGACTGAGGTTCTGTAAAGGATCTAGAGAAGTTTATTTGAAAATAAGAAGCATTGCAAATGGCAGTAGTGAAAAAGGTTGGAAAAGAG
Blast it in NCBI, it doesn't give EML4, but only gives:
Homo sapiens BAC clone RP11-379A23 from 2, complete sequence
As @Jean-Karim pointed out below restricting the search space to "Human genomic + transcript" produces two matches which appear to be the correct result (EML4 isoform a/b).