How Can I Read The Output Of Exonerate In An External Sequence Viewer?
1
1
Entering edit mode
9.6 years ago
John ▴ 770

I have the following output file from Exonerate. I don't recognize this format and I am unable to open it in my usual sequence viewer (Geneious). Do you know what format this is in and can you recommend another sequence viewer to read it? (I would like a nicer aa view for putting in a publication). I've read the manual, but cannot find the file format. I hope that someone more experienced can recognize the format and recommend a reader for it.

C4 Alignment:
------------
         Query: tpi
        Target: Supercontig12 [revcomp]
         Model: protein2genome:local
     Raw score: 1276
   Query range: 177 -> 632
  Target range: 597441 -> 595632

    178 : PheSerPheArgLysLysArgValArgValLeuSerLysThrGluAspValLysGluS :    197
          ||| !!!:!|||! !:!!|||||||||  !:!!! !   .!!   ..!  !:!!  !!
          PheProTyrArgMetGluArgValArgProIleIleProAlaThrSerProGlnProI
 597441 : TTCCCCTACAGAATGGAAAGAGTCCGGCCGATTATACCTGCTACTTCTCCTCAACCGA : 597384

    198 : erSerLeuGlyGly<->ValValTyrTrpMetSerArgAspGlyArgValGln{A}   :    214
           !|||! !|||  !   |||:!!||||||||||||||||||  !|||||||||{|}  
          leSerProGlyGlnCysValLeuTyrTrpMetSerArgAspThrArgValGln{A}++
 597383 : TCTCTCCTGGACAATGTGTCCTTTATTGGATGTCACGAGATACCAGAGTACAA{G}gt : 597329
output sequence viewer • 3.8k views
ADD COMMENT
1
Entering edit mode
9.6 years ago
Leszek 4.1k

I recommend specifying --showtargetgff yes. This prints GFF to output file that can be used by any genome browser.

For other useful switches, look here.

ADD COMMENT

Login before adding your answer.

Traffic: 1759 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6