Alternate splicing-rMATS error

Question: Alternate splicing-rMATS error

4.5 years ago by

arunbodd • 10 wrote:

Hello all,

I am trying to analyze RNA-Seq data for alternate splice sites. I am using rMATS to do that but getting the following error:

File "RNASeq-MATS.py", line 231, in <module> myLen=len(output.strip().split('\t')[9]); IndexError: list index out of range

what might be possibly wrong?

Thank You.

rna-seq alternativesplicing rmats • 3.0k views

ADD COMMENT • link •

modified 4.5 years ago • written 4.5 years ago by arunbodd • 10

Are you sure you provided a BAM file with alignments? It's complaining because the first alignment in the BAM file you provided has fewer than 10 columns (there should always be at least 11). What's the output of samtools view alignments.bam | head -n 1 (n.b., replace alignments.bam with the file you're using as input)?

ADD REPLY • link written 4.5 years ago by Devon Ryan ♦ 98k

this is the output :

HWI-ST568_0055:2:1101:14836:3706#TGACCA 353     chr1    17941   1       50M     =       18296   405     GGTGCTTGCTCTGGATCCTGTGGCGGGGGGGGCTCTGCAGGCCAGGGGCC      ggggggggggggggggggggggggggegdBBBBBBBBBBBBBBBBBBBBB NM:i:3  NH:i:4  CC:Z:chr15      CP:i:102513175  HI:i:0
HWI-ST568_0055:2:1101:14836:3706#TGACCA 401     chr1    18296   1       50M     =       17941   -405    TTCTCAATCTTGGCCTGGGCCAAGGAGACCTTCTCTCCAATGGCCTGCAC      gegegebdgf\gggggggggeggfggggggggfffggggggggggggggg NM:i:0  NH:i:4  CC:Z:chr15      CP:i:102512820  HI:i:0

ADD REPLY • link modified 4.5 years ago by Devon Ryan ♦ 98k • written 4.5 years ago by arunbodd • 10

Odd. Maybe modify the source code to add a print(output.strip().split('\t')), just to see what it's getting.

ADD REPLY • link written 4.5 years ago by Devon Ryan ♦ 98k

I have tried it before, doesnt work. But now a new error arises. Index exception error.

2016-08-15 16:40:44,543 rMATS version: 3.2.4
2016-08-15 16:40:44,543 Start the program with [RNASeq-MATS.py -s1 /mnt/d/sratoolkit.2.7.0-win64/Output_sra/SRR1035213.$
2016-08-15 16:40:44,738 ################### folder names and associated input files #############
2016-08-15 16:40:44,738 SAMPLE_1\REP_1  /mnt/d/sratoolkit.2.7.0-win64/Output_sra/SRR1035213.fastq
2016-08-15 16:40:44,740 SAMPLE_2\REP_1  /mnt/d/sratoolkit.2.7.0-win64/Output_sra/SRR1035214.fastq
2016-08-15 16:40:44,740    #########################################################################

2016-08-15 16:40:44,740 start mapping..
2016-08-15 16:40:44,740 mapping the first sample
2016-08-15 16:40:44,740 There is an exception in mapping
2016-08-15 16:40:44,740 Exception: <type 'exceptions.IndexError'>
2016-08-15 16:40:44,740 Detail: list index out of range

ADD REPLY • link modified 4.5 years ago by Devon Ryan ♦ 98k • written 4.5 years ago by arunbodd • 10

Can you post the full command? This would make the most sense if you specified having paired-end data when you don't.

ADD REPLY • link written 4.5 years ago by Devon Ryan ♦ 98k

sry for the late reply, here is the command

python RNASeq-MATS.py -s1 /mnt/d/sratoolkit.2.7.0-win64/Output_sra/SRR1035213.fastq -s2 /mnt/d/sratoolkit.2.7.0-win64/Output_sra/SRR1035214.fastq -gtf /mnt/d/STARindex/hg19-GTF -bi /mnt/d/STARindex/hg19 -o ~/test_run -t paired -len 50 -a 8 -c 0.0001

ADD REPLY • link written 4.5 years ago by arunbodd • 10

You don't have paired-end data, don't use -t paired.

ADD REPLY • link written 4.5 years ago by Devon Ryan ♦ 98k

my bad, i am new to bioinfo. this is my first sem at school. sry fr this..

python RNASeq-MATS.py -s1 testData/231ESRP.25K.rep-1.R1.fastq:testData/231ESRP.25K.rep-1.R2.fastq,testData/231ESRP.25K.rep-2.R1.fastq:testData/231ESRP.25K.rep-2.R2.fastq -s2 testData/231EV.25K.rep-1.R1.fastq:testData/231EV.25K.rep-1.R2.fastq,testData/231EV.25K.rep-2.R1.fastq:testData/231EV.25K.rep-2.R2.fastq -gtf ~/tools/hg19-GTF -bi ~/tools/STARindex/hg19 -o out_test -t paired -len 50 -a 8 -c 0.0001 -analysis P

ADD REPLY • link modified 4.5 years ago • written 4.5 years ago by arunbodd • 10

Please use ADD COMMENT/ ADD REPLY to answer to earlier posts in the thread, to keep everything logically structured and easy to follow. In addition, it would be nice if you would approve (up-vote) answers here to show they helped you.

ADD REPLY • link written 4.5 years ago by WouterDeCoster ♦ 45k

What version of STAR do you have installed? This appears to be a bug in whatever version of it you have.

ADD REPLY • link written 4.5 years ago by Devon Ryan ♦ 98k

I am using STARv3. samtoolsv1.2 rMATSv3.2.4

ADD REPLY • link written 4.5 years ago by arunbodd • 10

STARv3 doesn't exist, the most recent version is 2.5.2a.

Edit: The option that's causing an error was introduced in version 2.3.1v, so if you're using anything older then you need to upgrade.

ADD REPLY • link modified 4.5 years ago • written 4.5 years ago by Devon Ryan ♦ 98k

2016-08-17 14:45:59,543 rMATS version: 3.2.4 2016-08-17 14:45:59,543 Start the program with [RNASeq-MATS.py -s1 testData/231ESRP.25K.rep-1.R1.fastq:testData/231ESRP.25K.rep-1.R2.fastq,testData/231ESRP.25K.rep-2.R1.fastq:testData/231E$ 2016-08-17 14:45:59,597 ################### folder names and associated input files ############# 2016-08-17 14:45:59,598 SAMPLE_1\REP_1 testData/231ESRP.25K.rep-1.R1.fastq:testData/231ESRP.25K.rep-1.R2.fastq 2016-08-17 14:45:59,598 SAMPLE_1\REP_2 testData/231ESRP.25K.rep-2.R1.fastq:testData/231ESRP.25K.rep-2.R2.fastq 2016-08-17 14:45:59,598 SAMPLE_2\REP_1 testData/231EV.25K.rep-1.R1.fastq:testData/231EV.25K.rep-1.R2.fastq 2016-08-17 14:45:59,599 SAMPLE_2\REP_2 testData/231EV.25K.rep-2.R1.fastq:testData/231EV.25K.rep-2.R2.fastq 2016-08-17 14:45:59,599 ######################################################################### 2016-08-17 14:45:59,599 start mapping.. 2016-08-17 14:45:59,599 mapping the first sample 2016-08-17 14:45:59,611 mapping sample_1, rep_1 is done with status 26112 2016-08-17 14:45:59,612 error in mapping sample_1, rep_1: 26112 2016-08-17 14:45:59,612 error detail: EXITING: FATAL INPUT ERROR: unrecoginzed parameter name "alignEndsType" in input "Command-Line-Initial" SOLUTION: use correct parameter name (check the manual) Aug 17 14:45:59 ...... FATAL ERROR, exiting 2016-08-17 14:45:59,612 There is an exception in mapping 2016-08-17 14:45:59,612 Exception: <type 'exceptions.Exception'> 2016-08-17 14:45:59,612 Detail:

Similar posts • Search »