Question: Alternate splicing-rMATS error
0
gravatar for arunbodd
4.5 years ago by
arunbodd10
arunbodd10 wrote:

Hello all,

I am trying to analyze RNA-Seq data for alternate splice sites. I am using rMATS to do that but getting the following error:

File "RNASeq-MATS.py", line 231, in <module> myLen=len(output.strip().split('\t')[9]); IndexError: list index out of range

what might be possibly wrong?

Thank You.

ADD COMMENTlink modified 4.5 years ago • written 4.5 years ago by arunbodd10
1

Are you sure you provided a BAM file with alignments? It's complaining because the first alignment in the BAM file you provided has fewer than 10 columns (there should always be at least 11). What's the output of samtools view alignments.bam | head -n 1 (n.b., replace alignments.bam with the file you're using as input)?

ADD REPLYlink written 4.5 years ago by Devon Ryan98k

this is the output :

HWI-ST568_0055:2:1101:14836:3706#TGACCA 353     chr1    17941   1       50M     =       18296   405     GGTGCTTGCTCTGGATCCTGTGGCGGGGGGGGCTCTGCAGGCCAGGGGCC      ggggggggggggggggggggggggggegdBBBBBBBBBBBBBBBBBBBBB NM:i:3  NH:i:4  CC:Z:chr15      CP:i:102513175  HI:i:0
HWI-ST568_0055:2:1101:14836:3706#TGACCA 401     chr1    18296   1       50M     =       17941   -405    TTCTCAATCTTGGCCTGGGCCAAGGAGACCTTCTCTCCAATGGCCTGCAC      gegegebdgf\gggggggggeggfggggggggfffggggggggggggggg NM:i:0  NH:i:4  CC:Z:chr15      CP:i:102512820  HI:i:0
ADD REPLYlink modified 4.5 years ago by Devon Ryan98k • written 4.5 years ago by arunbodd10

Odd. Maybe modify the source code to add a print(output.strip().split('\t')), just to see what it's getting.

ADD REPLYlink written 4.5 years ago by Devon Ryan98k

I have tried it before, doesnt work. But now a new error arises. Index exception error.

2016-08-15 16:40:44,543 rMATS version: 3.2.4
2016-08-15 16:40:44,543 Start the program with [RNASeq-MATS.py -s1 /mnt/d/sratoolkit.2.7.0-win64/Output_sra/SRR1035213.$
2016-08-15 16:40:44,738 ################### folder names and associated input files #############
2016-08-15 16:40:44,738 SAMPLE_1\REP_1  /mnt/d/sratoolkit.2.7.0-win64/Output_sra/SRR1035213.fastq
2016-08-15 16:40:44,740 SAMPLE_2\REP_1  /mnt/d/sratoolkit.2.7.0-win64/Output_sra/SRR1035214.fastq
2016-08-15 16:40:44,740    #########################################################################

2016-08-15 16:40:44,740 start mapping..
2016-08-15 16:40:44,740 mapping the first sample
2016-08-15 16:40:44,740 There is an exception in mapping
2016-08-15 16:40:44,740 Exception: <type 'exceptions.IndexError'>
2016-08-15 16:40:44,740 Detail: list index out of range
ADD REPLYlink modified 4.5 years ago by Devon Ryan98k • written 4.5 years ago by arunbodd10

Can you post the full command? This would make the most sense if you specified having paired-end data when you don't.

ADD REPLYlink written 4.5 years ago by Devon Ryan98k

sry for the late reply, here is the command

python RNASeq-MATS.py -s1 /mnt/d/sratoolkit.2.7.0-win64/Output_sra/SRR1035213.fastq -s2 /mnt/d/sratoolkit.2.7.0-win64/Output_sra/SRR1035214.fastq -gtf /mnt/d/STARindex/hg19-GTF -bi /mnt/d/STARindex/hg19 -o ~/test_run -t paired -len 50 -a 8 -c 0.0001

ADD REPLYlink written 4.5 years ago by arunbodd10

You don't have paired-end data, don't use -t paired.

ADD REPLYlink written 4.5 years ago by Devon Ryan98k

my bad, i am new to bioinfo. this is my first sem at school. sry fr this..

python RNASeq-MATS.py -s1 testData/231ESRP.25K.rep-1.R1.fastq:testData/231ESRP.25K.rep-1.R2.fastq,testData/231ESRP.25K.rep-2.R1.fastq:testData/231ESRP.25K.rep-2.R2.fastq -s2 testData/231EV.25K.rep-1.R1.fastq:testData/231EV.25K.rep-1.R2.fastq,testData/231EV.25K.rep-2.R1.fastq:testData/231EV.25K.rep-2.R2.fastq -gtf ~/tools/hg19-GTF -bi ~/tools/STARindex/hg19 -o out_test -t paired -len 50 -a 8 -c 0.0001 -analysis P

ADD REPLYlink modified 4.5 years ago • written 4.5 years ago by arunbodd10
1

Please use ADD COMMENT/ ADD REPLY to answer to earlier posts in the thread, to keep everything logically structured and easy to follow. In addition, it would be nice if you would approve (up-vote) answers here to show they helped you.

ADD REPLYlink written 4.5 years ago by WouterDeCoster45k

What version of STAR do you have installed? This appears to be a bug in whatever version of it you have.

ADD REPLYlink written 4.5 years ago by Devon Ryan98k

I am using STARv3. samtoolsv1.2 rMATSv3.2.4

ADD REPLYlink written 4.5 years ago by arunbodd10

STARv3 doesn't exist, the most recent version is 2.5.2a.

Edit: The option that's causing an error was introduced in version 2.3.1v, so if you're using anything older then you need to upgrade.

ADD REPLYlink modified 4.5 years ago • written 4.5 years ago by Devon Ryan98k
0
gravatar for arunbodd
4.5 years ago by
arunbodd10
arunbodd10 wrote:

hey, i bumped into this error now:

2016-08-17 14:45:59,543 rMATS version: 3.2.4
2016-08-17 14:45:59,543 Start the program with [RNASeq-MATS.py -s1 testData/231ESRP.25K.rep-1.R1.fastq:testData/231ESRP.25K.rep-1.R2.fastq,testData/231ESRP.25K.rep-2.R1.fastq:testData/231E$

2016-08-17 14:45:59,597 ################### folder names and associated input files #############
2016-08-17 14:45:59,598 SAMPLE_1\REP_1  testData/231ESRP.25K.rep-1.R1.fastq:testData/231ESRP.25K.rep-1.R2.fastq
2016-08-17 14:45:59,598 SAMPLE_1\REP_2  testData/231ESRP.25K.rep-2.R1.fastq:testData/231ESRP.25K.rep-2.R2.fastq
2016-08-17 14:45:59,598 SAMPLE_2\REP_1  testData/231EV.25K.rep-1.R1.fastq:testData/231EV.25K.rep-1.R2.fastq
2016-08-17 14:45:59,599 SAMPLE_2\REP_2  testData/231EV.25K.rep-2.R1.fastq:testData/231EV.25K.rep-2.R2.fastq
2016-08-17 14:45:59,599 #########################################################################

2016-08-17 14:45:59,599 start mapping..
2016-08-17 14:45:59,599 mapping the first sample
2016-08-17 14:45:59,611 mapping sample_1, rep_1 is done with status 26112
2016-08-17 14:45:59,612 error in mapping sample_1, rep_1: 26112
2016-08-17 14:45:59,612 error detail:
EXITING: FATAL INPUT ERROR: unrecoginzed parameter name "alignEndsType" in input "Command-Line-Initial"
SOLUTION: use correct parameter name (check the manual)

Aug 17 14:45:59 ...... FATAL ERROR, exiting
2016-08-17 14:45:59,612 There is an exception in mapping
2016-08-17 14:45:59,612 Exception: <type 'exceptions.Exception'>
2016-08-17 14:45:59,612 Detail:
ADD COMMENTlink modified 4.5 years ago by Devon Ryan98k • written 4.5 years ago by arunbodd10

If you want people to help you you'll really need to get in the habit of providing enough details to do so. In this case, you forgot to post the entire command you used.

ADD REPLYlink written 4.5 years ago by Devon Ryan98k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1894 users visited in the last hour
_