Question: Most reads counted by HTSeq are "unaligned"
gravatar for dazhudou1122
3.5 years ago by
dazhudou112250 wrote:

Hey guys,

I am new to RNA-Seq. I am trying to map some human tissue (contains bacteria) reads to a bacterial genome. I have used bowtie2 to filter all the remaining human reads, and mapped to a reference genome using:

bowtie2 -x /Users/winterlab/Desktop/Sequencing/RNA_seq_pipeline/bowtie2-2.2.9/Indexes/Fusobacterium_ATCC25586 -1 /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/Filtered_reads/SRR3170861.fastq -2 /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/Filtered_reads/SRR3170862.fastq -S /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/Reads_mapped_to_Fuso/FusoSRR317086.sam -p 3

And if I do have some reads mapped (using samtools flagstat) :

3615588 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
0 + 0 supplementary
0 + 0 duplicates
32849 + 0 mapped (0.91% : N/A)
3615588 + 0 paired in sequencing
1807794 + 0 read1
1807794 + 0 read2
654 + 0 properly paired (0.02% : N/A)
15826 + 0 with itself and mate mapped
17023 + 0 singletons (0.47% : N/A)
0 + 0 with mate mapped to a different chr
0 + 0 with mate mapped to a different chr (mapQ>=5)

But when I used HTSeq to count reads, mots of the reads are un-aligned:

(python -m HTSeq.scripts.count -s no -i ID /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/Reads_mapped_to_Fuso/sorted.sam /Users/winterlab/Desktop/Sequencing/RNA_seq_pipeline/Reference_genome_and_gff/ATCC_25586.gff)

4174 GFF lines processed.
Warning: Malformed SAM line: RNAME != '*' although flag bit &0x0004 set
Warning: Malformed SAM line: MRNM == '=' although read is not aligned.
Warning: Malformed SAM line: MRNM != '*' although flag bit &0x0008 set
100000 SAM alignment record pairs processed.
200000 SAM alignment record pairs processed.
300000 SAM alignment record pairs processed.
400000 SAM alignment record pairs processed.
id10    0
id11    0
id12    0
id13    0
id14    0
id15    0
id16    0
id17    0
id18    0
id19    0
__no_feature    13
__ambiguous 0
__too_low_aQual 24922
__not_aligned   1782858
__alignment_not_unique  0

The first few lines of the gff file: ##gff-version 3

 #!gff-spec-version 1.21
    #!processor NCBI annotwriter
    #!genome-build ASM732v1
    #!genome-build-accession NCBI_Assembly:GCF_000007325.1
    ##sequence-region NC_003454.1 1 2174500
    NC_003454.1 RefSeq  region  1   2174500 .   +   .   ID=id0;Dbxref=ATCC:25586,taxon:190304;Is_circular=true;Name=ANONYMOUS;gbkey=Src;genome=chromosome;mol_type=genomic DNA;strain=ATCC 25586;sub-species=nucleatum
    NC_003454.1 RefSeq  gene    77  709 .   -   .   ID=gene0;Dbxref=GeneID:992632;Name=FN1496;gbkey=Gene;gene_biotype=protein_coding;locus_tag=FN1496
    NC_003454.1 RefSeq  CDS 77  709 .   -   0   ID=cds0;Parent=gene0;Dbxref=Genbank:NP_602323.1,GeneID:992632;Name=NP_602323.1;gbkey=CDS;product=spore coat protein regulator protein YlbO;protein_id=NP_602323.1;transl_table=11
    NC_003454.1 RefSeq  gene    1104    2228    .   -   .   ID=gene1;Dbxref=GeneID:992723;Name=FN1497;gbkey=Gene;gene_biotype=protein_coding;locus_tag=FN1497
    NC_003454.1 RefSeq  CDS 1104    2228    .   -   0   ID=cds1;Parent=gene1;Dbxref=Genbank:NP_602324.1,GeneID:992723;Name=NP_602324.1;gbkey=CDS;product=multidrug resistance protein 2;protein_id=NP_602324.1;transl_table=11
    NC_003454.1 RefSeq  gene    2703    3602    .   +   .

First few lines of sam file :

@HD VN:1.0  SO:queryname
@SQ SN:NC_003454.1  LN:2174500
@PG ID:bowtie2  PN:bowtie2  VN:2.2.9    CL:"/Users/winterlab/Desktop/Sequencing/RNA_seq_pipeline/bowtie2-2.2.9/bowtie2-align-s --wrapper basic-0 -x /Users/winterlab/Desktop/Sequencing/RNA_seq_pipeline/bowtie2-2.2.9/Indexes/Fusobacterium_ATCC25586 -S /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/Reads_mapped_to_Fuso/FusoSRR317089.sam -p 3 -1 /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/Filtered_reads/SRR3170891.fastq -2 /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/Filtered_reads/SRR3170892.fastq"
SRR317089.45    77  *   0   0   *   *   0   0   CTTGGCTGTGGTTTCGCTGG    BCC?B@CC=@C@CCC@@@@@    YT:Z:UP
SRR317089.45    141 *   0   0   *   *   0   0   AGGGGAATCCGACTGTTTAATTAAAACA    @@@@@=?@0@@@@@@@@@=@@@@@@@@@    YT:Z:UP
SRR317089.56    77  *   0   0   *   *   0   0   CATCGTTTATGGTCGGAACTACGACGGTATCTGATCGTCTTCGAACCTC   @@CC@=CC?C7789<::::2>>9+9B?1??BAA9=AA5A<2?B?5AA3A   YT:Z:UP
SRR317089.56    141 *   0   0   *   *   0   0   CGCAGCTAGGAATAATGGAATAGGACCGCGGTTCTATTTTGTTGGTTTTCGGAACTGAGGCCATGATGAAGAG   BAAB<A??<B??9<B6699>BA6@BA<A6A?=BA<<?B85??2988<8(9>>89;40??19???86:+3/?3?   YT:Z:UP
SRR317089.58    77  *   0   0   *   *   0   0   GAACAAGATGCAGAACCATGGCTATGAGAACCCCACCTACAAATACCTGGAGCAG AA>A?8>>.>47>09A8B?;8**<<9+.95:84?86(379;/:A?6?3?3'>7=@ YT:Z:UP

So I made sure the chromosome names are matching and everything so I cant figure out why.

Any input is highly appreciated:)

rna-seq alignment • 1.4k views
ADD COMMENTlink modified 3.5 years ago by genomax78k • written 3.5 years ago by dazhudou112250

< 1% reads mapped should be the first cause for concern.

Your filter step appears to have either failed or removed the bacterial reads as well. Look into a read-binning strategy using BBsplit and the original data files.

ADD REPLYlink modified 3.5 years ago • written 3.5 years ago by genomax78k

Thanks for all the inputs guys! I appreciate it! I did what genomax2 and WouterDeCoster suggested, and skipped the "filtering human reads" step but it seems that the result is still pretty much the same:

id10    0
id11    0
id12    0
id13    0
id14    0
id15    0
id16    0
id17    0
id18    0
id19    0
id2 0
id20    0
id21    0
id22    0
id23    0
id24    0
id25    0
id26    0
id27    0
id28    0
id29    0
id3 0
id30    0
id31    0
id32    0
id33    0
id34    0
id35    0
id36    0
id37    0
id38    0
id39    0
id4 0
id40    0
id41    0
id42    0
id43    0
id44    0
id45    39
id46    0
id47    0
id48    0
id49    0
id5 0
id50    0
id51    0
id52    0
id53    0
id56    0
id57    0
id58    0
id59    0
id6 0
id60    0
id61    0
id62    0
id64    0
id65    0
id66    0
id7 0
id8 1
id9 0
__no_feature    45
__ambiguous 0
__too_low_aQual 30850
__not_aligned   2057335
__alignment_not_unique  0

As for the low mapped reads, it is kind of expected, because I am mapping human tissue reads to one single bacterial genome (there are a lot other bacteria present there). With that being said, I should have 2088270*0.96% overall alignment rate=20047 reads. That is the case when I searched for "NC_003454.1" in the sam file. I am so confused...

ADD REPLYlink modified 3.5 years ago by genomax78k • written 3.5 years ago by dazhudou112250

Is the chromosome ID (should be only one or two if there is a plasmid) matching in your sam file and the annotation file you are using?

ADD REPLYlink written 3.5 years ago by genomax78k

Thanks for the comments, genomax2! Can you specify what is the chromosome ID here? I am not sure that I understand correctly. Here are the first few lines of the gff file:

##gff-version 3
#!gff-spec-version 1.21
#!processor NCBI annotwriter
#!genome-build ASM732v1
#!genome-build-accession NCBI_Assembly:GCF_000007325.1
##sequence-region NC_003454.1 1 2174500
NC_003454.1 RefSeq  region  1   2174500 .   +   .   ID=id0;Dbxref=ATCC:25586,taxon:190304;Is_circular=true;Name=ANONYMOUS;gbkey=Src;genome=chromosome;mol_type=genomic DNA;strain=ATCC 25586;sub-species=nucleatum
NC_003454.1 RefSeq  gene    77  709 .   -   .   ID=gene0;Dbxref=GeneID:992632;Name=FN1496;gbkey=Gene;gene_biotype=protein_coding;locus_tag=FN1496
NC_003454.1 RefSeq  CDS 77  709 .   -   0   ID=cds0;Parent=gene0;Dbxref=Genbank:NP_602323.1,GeneID:992632;Name=NP_602323.1;gbkey=CDS;product=spore coat protein regulator protein YlbO;protein_id=NP_602323.1;transl_table=11
NC_003454.1 RefSeq  gene    1104    2228    .   -   .   ID=gene1;Dbxref=GeneID:992723;Name=FN1497;gbkey=Gene;gene_biotype=protein_coding;locus_tag=FN1497
NC_003454.1 RefSeq  CDS 1104    2228    .   -   0   ID=cds1;Parent=gene1;Dbxref=Genbank:NP_602324.1,GeneID:992723;Name=NP_602324.1;gbkey=CDS;product=multidrug resistance protein 2;protein_id=NP_602324.1;transl_table=11
NC_003454.1 RefSeq  gene    2703    3602    .   +   .   ID=gene2;Dbxref=GeneID:992745;Name=FN1498;gbkey=Gene;gene_biotype=protein_coding;locus_tag=FN1498
NC_003454.1 RefSeq  CDS 2703    3602    .   +   0   ID=cds2;Parent=gene2;Dbxref=Genbank:NP_602325.1,GeneID:992745;Name=NP_602325.1;gbkey=CDS;product=hypothetical protein;protein_id=NP_602325.1;transl_table=11
NC_003454.1 RefSeq  gene    3787    5226    .   +   .   ID=gene3;Dbxref=GeneID:991278;Name=FN1499;gbkey=Gene;gene_biotype=protein_coding;locus_tag=FN1499
NC_003454.1 RefSeq  CDS 3787    5226    .   +   0   ID=cds3;Parent=gene3;Dbxref=Genbank:NP_602326.1,GeneID:991278;Name=NP_602326.1;gbkey=CDS;product=cell surface protein;protein_id=NP_602326.1;transl_table=11
NC_003454.1 RefSeq  gene    5283    6017    .   -   .   ID=gene4;Dbxref=GeneID:992647;Name=FN1500;gbkey=Gene;gene_biotype=protein_coding;locus_tag=FN1500
NC_003454.1 RefSeq  CDS 5283    6017    .   -   0   ID=cds4;Parent=gene4;Dbxref=Genbank:NP_602327.1,GeneID:992647;Name=NP_602327.1;gbkey=CDS;product=nickel transport ATP-binding protein NikE;protein_id=NP_602327.1;transl_table=11
NC_003454.1 RefSeq  gene    6018    6800    .   -   .
ADD REPLYlink modified 3.5 years ago by genomax78k • written 3.5 years ago by dazhudou112250

Could you show us the chromosomes/contigs/... as those are present in the sam file, using samtools idxstats?

ADD REPLYlink written 3.5 years ago by WouterDeCoster43k

It seems that samtools idxstats only works on bam files. Because I set the output of the bowtie2 alignment as sam file, I did not convert them to bam. Do you think that could be a problem? Also, because I can open sam file in a text editor, I post the first few lines of the sam file in here:

@HD VN:1.0  SO:unsorted
@SQ SN:NC_003454.1  LN:2174500
@PG ID:bowtie2  PN:bowtie2  VN:2.2.9    CL:"/Users/winterlab/Desktop/Sequencing/RNA_seq_pipeline/bowtie2-2.2.9/bowtie2-align-s --wrapper basic-0 -x /Users/winterlab/Desktop/Sequencing/RNA_seq_pipeline/bowtie2-2.2.9/Indexes/Fusobacterium_ATCC25586 -S /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/Unfiltered_reads_mapped_to_Fuso/FusoCleanSRR317086.sam -p 3 -1 /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/paired_end_reads/CleanSRR317086_1.fastq -2 /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/paired_end_reads/CleanSRR317086_2.fastq"
SRR317086.603   77  *   0   0   *   *   0   0   GGAGACACCGCCGCAGTTGCCGGTACATCGGGGATT    <<>>:;;><>:<;<+?????AABA>877<<798(3?    YT:Z:UP
SRR317086.604   77  *   0   0   *   *   0   0
ADD REPLYlink modified 3.5 years ago by genomax78k • written 3.5 years ago by dazhudou112250

I blasted GTAGCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTACGCACGGCCGGTACAGTGAAACTGCGAATGG, turns out to be ribosomal RNA. How was the library prep performed? Ribo depletion or poly A selection?

ADD REPLYlink written 3.5 years ago by WouterDeCoster43k

The library was prep using Ribo depletion.

ADD REPLYlink written 3.5 years ago by dazhudou112250

Chromosome id is NC_003454.1. You can either use @Wouter's command or show us the output of samtools view -H your_file.sam.

ADD REPLYlink written 3.5 years ago by genomax78k

I did what you suggested, and here is the out put:

@HD VN:1.0  SO:unsorted
@SQ SN:NC_003454.1  LN:2174500
@PG ID:bowtie2  PN:bowtie2  VN:2.2.9    CL:"/Users/winterlab/Desktop/Sequencing/RNA_seq_pipeline/bowtie2-2.2.9/bowtie2-align-s --wrapper basic-0 -x /Users/winterlab/Desktop/Sequencing/RNA_seq_pipeline/bowtie2-2.2.9/Indexes/Fusobacterium_ATCC25586 -S /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/Unfiltered_reads_mapped_to_Fuso/FusoCleanSRR317086.sam -p 3 -1 /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/paired_end_reads/CleanSRR317086_1.fastq -2 /Users/winterlab/Desktop/Sequencing/Fuso_RNA-seq_raw-data/paired_end_reads/CleanSRR317086_2.fastq"
ADD REPLYlink modified 3.5 years ago by genomax78k • written 3.5 years ago by dazhudou112250

At least the chromosome name is matching in your sam and annotation file. I think counting may not be working because your sam file is not sorted (look at the header). I suggest that you sort your file using samtools sort (convert it to BAM) and then count.

Alternatively you could use featureCounts to do the counting. It can sort the files as needed.

ADD REPLYlink modified 3.5 years ago • written 3.5 years ago by genomax78k

Thank you so much, genomax2! You are life saver! featureCounts worked beautifully!

ADD REPLYlink written 3.5 years ago by dazhudou112250
gravatar for WouterDeCoster
3.5 years ago by
WouterDeCoster43k wrote:

The problem is not in the HTSeq-count step, the reads really are mostly unmapped. Something went wrong in the mapping... Why do you use bowtie and not tophat/hisat/star? Bowtie isn't aware of splice sites which will likely be your problem.

ADD COMMENTlink written 3.5 years ago by WouterDeCoster43k

OP is using bowtie2 (with a bacterial reference). It appears that the "filtering human reads out", referred to by OP, must not have worked right.

ADD REPLYlink modified 3.5 years ago • written 3.5 years ago by genomax78k

You're right, should have read it more focussed :(

ADD REPLYlink written 3.5 years ago by WouterDeCoster43k

Thanks for all the inputs guys! I appreciate it! I did what genomax2 and WouterDeCoster suggested, and skipped the "filtering human reads" step but it seems that the result is still pretty much the same: id10 0 id11 0 id12 0 id13 0 id14 0 id15 0 id16 0 id17 0 id18 0 id19 0 id2 0 id20 0 id21 0 id22 0 id23 0 id24 0 id25 0 id26 0 id27 0 id28 0 id29 0 id3 0 id30 0 id31 0 id32 0 id33 0 id34 0 id35 0 id36 0 id37 0 id38 0 id39 0 id4 0 id40 0 id41 0 id42 0 id43 0 id44 0 id45 39 id46 0 id47 0 id48 0 id49 0 id5 0 id50 0 id51 0 id52 0 id53 0 id56 0 id57 0 id58 0 id59 0 id6 0 id60 0 id61 0 id62 0 id64 0 id65 0 id66 0 id7 0 id8 1 id9 0 __no_feature 45 __ambiguous 0 __too_low_aQual 30850 __not_aligned 2057335 __alignment_not_unique 0

As for the low mapped reads, it is kind of expected, because I am mapping human tissue reads to one single bacterial genome (there are a lot other bacteria present there). With that being said, I should have 2088270*0.96% overall alignment rate=20047 reads. That is the case when I searched for "NC_003454.1" in the sam file. I am so confused...

ADD REPLYlink written 3.5 years ago by dazhudou112250
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 676 users visited in the last hour