Entering edit mode
8.4 years ago
Bioinfonext
▴
470
I am getting error while running fastqc on one of the pair end fastq file:
/home/yog/software/FastQC/fastqc -t 8 -o /data/Analysis/data_new/qc/ /data/Analysis/data_new/AS_0_R2_001.fastq
Failed to process /data/Analysis/data_new/AS_0_R2.fastq
uk.ac.babraham.FastQC.Sequence.SequenceFormatException: ID line didn't start with '@'
I also tried repair.sh from bbmap:
[root@psgl data_new]# /home/yog/software/bbmap/repair.sh in1=AS_0_R1.fastq in2=AS_0_R2_001.fastq out1=AS_0_R1.fastq out2=AS_0_R2.fastq outsingle=singletons.fastq
java -ea -Xmx204663m -cp /home/yog/software/bbmap/current/ jgi.SplitPairsAndSingles rp in1=AS_0_L003_R1.fastq
in2=AS_0_CGATGT_L007_R2_001.fastq out1=AS_0_R1.fastq out2=AS_0_R2.fastq outsingle=singletons.fastq
Executing jgi.SplitPairsAndSingles [rp, in1=AS_0_R1.fastq, in2=AS_0_R2.fastq, out1=AS_0_R1.fastq, out2=AS_0_R2.fastq, outsingle=singletons.fastq]
Set INTERLEAVED to false
**Exception in thread "Thread-2" java.lang.AssertionError:**
Error in AS_0_R2.fastq, line 3, with these 4 lines:
HHFFFFFEEDEEEDDDDDDDDDDDDDDDBDDDDBCC>
@HWI-1KL175:31:D1Y8NACXX:7:1101:6792:2151 2:N:0:CGATGT
GTTTTAAAGAAGTGAGACTTGTGAGCAAGGAATCTAAACATGCCGGAGGAGACCCTCTTATATTATGCTTTGTTGATTTCTCGACCCCTAGCCATGCAGCC
+
How can I delete these?
awk '{if(NR>3) print}' input.fastq > output.fastq
That's assuming the error is the first 3 lines. While that's what the error message suggests, do have a look to check.