Question: Receiving an error when using blastn remotely within a loop. "service not found" "null_connector" "Cannot read header" "Unable to read data" and "Failed to flush"
0
gravatar for Jacob
3.7 years ago by
Jacob10
Jacob10 wrote:

I"m receiving the errors below when running this script. I don't know what the errors mean or how to fix them. Is it possible I was blocked from the blast server?

Script I'm running

for org in "Homo sapiens" "Mus musculus" ... ...
do
        for gene in Acan ... ... ...
        do
        blastn -query geneFiles/$Gene -db refseq_genomic -out "outputfile" -evalue 0.00001 -outfmt 6 -entrez_query "${org}[Orgnanism] AND refseq[filter]" -remote
        done
done

geneFiles/Acan (Example of one of the files I'm passing to the script

>NM_013227.3 Homo sapiens aggrecan (ACAN), transcript variant 2, mRNA
CACCTACCTCCCCGCCGCTCCAGAGGGGGCTCGCAGAGCTGAGGACGCGCGCAGCGCTGCTCAAGGTCTC
...

Errors (Repeats over and over)

Error: (308.5) [blastn] [blast4]  Service not found
Error: (315.2) [blastn] CConn_Streambuf::CConn_Streambuf():  NULL connector: Unknown
Error: (802.5) [blastn] CObjectOStream: error at byte 93: stack is empty: write fault
Warning: (307.8) [blastn] [HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0]  Cannot read header (Timeout)
Error: (301.23) [blastn] [CONN_Read(blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0)]  Unable to read data: Timeout[30.000000]
Error: (315.8) [blastn] CConn_Streambuf::underflow():  CONN_Read() failed (blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0): Timeout
Warning: (301.21) [blastn] [CONN_Flush(blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0)]  Failed to flush: Closed
Error: (315.9) [blastn] CConn_Streambuf::overflow():  CONN_Flush() failed (blast4/HTTP; https://www.ncbi.nlm.nih.gov/Service/dispd.cgi?service=blast4&address=sanger.usask.ca&platform=x86_64-apple-darwin14.5.0): Closed
blastn blast+ blast • 1.5k views
ADD COMMENTlink modified 3.7 years ago by GenoMax95k • written 3.7 years ago by Jacob10
1

Consider changing to a short/informative title for your post. Using an error message as is, is never informative.

ADD REPLYlink modified 3.7 years ago • written 3.7 years ago by GenoMax95k

What would you recommend, I don't know what else to post because all I know is that this error is happening

ADD REPLYlink written 3.7 years ago by Jacob10
1

How about "Error(s) with remote blast".

Did you verify with one or two sequences that the searches were working before using the full scale double loop?

ADD REPLYlink written 3.7 years ago by GenoMax95k

Are you behind a proxy/firewall? Are you using the latest blast+ executables? You should also limit remote blast calls to a certain number per unit time otherwise your IP may be blacklisted by NCBI.

ADD REPLYlink modified 3.7 years ago • written 3.7 years ago by GenoMax95k

I haven't had firewall problems with previous blast commands I've executed, but I'm not sure if I'm behind one.

I just downloaded blast+ last week so I am probably on the latest.

I put in a sleep command into my loop but I might already be blacklisted. Is there a way I can fix that?

ADD REPLYlink modified 3.7 years ago • written 3.7 years ago by Jacob10
1

If your IP is black listed (run a single search to see if it goes through to check) then wait a day or so until the block ages out. Put in a longer delay between your jobs/run smaller batches at one time.

ADD REPLYlink written 3.7 years ago by GenoMax95k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2037 users visited in the last hour
_