Question: Bwa producing no alignment
1
gravatar for ThePresident
3.8 years ago by
ThePresident160
ThePresident160 wrote:

I am dealing with Illumina paired-end, 150 bp read-length datasets.

Here's what my fastq files looklike:

@SRR3405394.1 1 length=151
NCGACTGAGGTAATTACAGTTCTTCGGTTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCCGCACTCGGCCCAGGCGGTCTGACCCGTGAACGTGCAGGGTACAGATCGGAA
+SRR3405394.1 1 length=151
#<GGGGAGGIGGGIGGIIIIIGIIIIIIIIIIGIIIIIIIGGIIGIGGIIIIIGIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIGIGGIGGIIGGIIIIIGGGIIIIIGGIIIIGIIIGIGII<GGGGAGIGGAGG

I use this command to align with bwa:

bwa aln -t8 index 1.fastq > 1.sai
bwa aln -t8 index 2.fastq > 2.sai
bwa sampe index 1.sai 2.sai 1.fastq 2.fastq > aln_bwa.sam

When I look at my SAM file, I see this:

@SQ SN:selected LN:4641665
@PG ID:bwa  PN:bwa  VN:0.7.13-r1126 CL:bwa sampe index 1.sai 2.sai 1.fastq 2.fastq
SRR3405394.1    77  *   0   0   *   *   0   0   NCGACTGAGGTAATTACAGTTCTTCGGTTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCCGCACTCGGCCCAGGCGGTCTGACCCGTGAACGTGCAGGGTACAGATCGGAA #<GGGGAGGIGGGIGGIIIIIGIIIIIIIIIIGIIIIIIIGGIIGIGGIIIIIGIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIGIGGIGGIIGGIIIIIGGGIIIIIGGIIIIGIIIGIGII<GGGGAGIGGAGG
SRR3405394.1    141 *   0   0   *   *   0   0   GTACCCTGCACGTTCACGGGTCAGACCGCCTGGGCCGAGTGCGGAGATACGACGTTTGTGCGTAATCTCAGACAGCGGGTTGTTCTGGTCCATAAACTGAGACAGCTGGCTGGAACCGAAGAACTGTAATTACCTCAGTCGTAGATCGGAA GGAAGIIGIIIGIGIIGGGIIGGGGIGGIIAGGGIIGGGGGIGIGGGGIIGGGIGGGGGIIIIIGGIIIIIIIIIIIIGIIIGIIIIGIIIGGIIIGIIIIAGGIIIGGAGIGGGGGGI<GGGGIIIIIGGGIGIIIGIIIIIAGGIIIIG

All my reads are flagged 77 / 141, i.e. they're not aligned. What's the problem? I have a feeling that the quality scores are not recognized, but that's just a wild guess based on some quick reading.

Thank you in advance, TP

bwa • 1.9k views
ADD COMMENTlink modified 3.6 years ago by Biostar ♦♦ 20 • written 3.8 years ago by ThePresident160
2

Do you have a reason to use bwa aln rather than bwa mem?

ADD REPLYlink written 3.8 years ago by WouterDeCoster45k
1

I am interested in extracting aberrant pairs (same orientation fwd-fwd and bkw-bkw combinations). I know that bwa aln is able to mark them properly but I am not sure about bwa mem. Do you happen to know if bwa mem handles these type of pairs the same way as bwa aln does?

ADD REPLYlink written 3.8 years ago by ThePresident160

Just out of curiosity: why are you running aln and index at the same time? For what I remember aln is used to align and should create a sai output, while index is used to create an index of a fasta reference file.

ADD REPLYlink written 3.6 years ago by Fabio Marroni2.7k
1

I guess index is a placeholder for the path to his index file?

ADD REPLYlink written 3.6 years ago by WouterDeCoster45k

Correct, index is placeholder for my index file.

ADD REPLYlink written 3.6 years ago by ThePresident160

Is it possible that you have quality in Illumina 1.3+ or 1.5+ while (I think) bwa is now expecting Illumina 1.8+? Try giving a look at these posts:

What Is The Default Quality Encoding Expected By Bwa?

Convert Illumina 1.3 To Illumina 1.5

https://en.wikipedia.org/wiki/FASTQ_format

ADD REPLYlink written 3.6 years ago by Fabio Marroni2.7k

I did this awhile ago but I believe I verified that I have 1.8+ Illumina score. If I remember correctly FastQC can detect what scores are used.

ADD REPLYlink written 3.6 years ago by ThePresident160

mmm, yes, I noticed you have # in the quality, which cannot be Illumina 1.3+ nor 1.5+.

1) Why do you think it is something in the quality? Did you receive some warning?

2) Have you tried building a small reference identical to one of your reads and aligning against it?

ADD REPLYlink modified 3.6 years ago • written 3.6 years ago by Fabio Marroni2.7k

1) Googling here and there led me to think that quality scores might be a problem but now I know it shouldn't be. 2) Nope, but that's a good idea. I'll try it.

ADD REPLYlink written 3.6 years ago by ThePresident160
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1545 users visited in the last hour
_