Question: Trimmomatic: Missing sequence line from record
gravatar for ddzhangzz
19 months ago by
United States
ddzhangzz90 wrote:

My RNASeq data appear about 3% adapter contamination and I was trying to trim them using Trimmomatic (v.0.36) but it seems it doesn't work correctly. I got below message a second after I run the program: TrimmomaticPE: Started with arguments:

-threads 8 -phred33 -trimlog DRR091550log DRR091550_1.fastq.bz2 DRR091550_2.fastq.bz2 DRR091550_forward_paired.fastq.bz2 DRR091550_forward_unpaired.fastq.bz2 DRR091550_reverse_paired.fastq.bz2 DRR091550_reverse_unpaired.fastq.bz2 ILLUMINACLIP:TruSeq3PE.fa:1:30:10 
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences

Exception in thread "Thread-0" Exception in thread "Thread-1" java.lang.RuntimeException: Missing sequence line from record: DRR091550.2646 HWI-ST886:245:C1T77ACXX:7:1101:17633:2535 length
Input Read Pairs: 2000 Both Surviving: 1953 (97.65%) Forward Only Surviving: 47 (2.35%) Reverse Only Surviving: 0 (0.00%) Dropped: 0 (0.00%)                                                                                                                                                                       
TrimmomaticPE: Completed successfully

Then I checked the record DRR091550.2646 HWI-ST886:245:C1T77ACXX:7:1101:17633:2535 and it seems nothing wrong:

@DRR091550.2646 HWI-ST886:245:C1T77ACXX:7:1101:17633:2535 length=101
+DRR091550.2646 HWI-ST886:245:C1T77ACXX:7:1101:17633:2535 length=101

@DRR091550.2646 HWI-ST886:245:C1T77ACXX:7:1101:17633:2535 length=101
+DRR091550.2646 HWI-ST886:245:C1T77ACXX:7:1101:17633:2535 length=101

Does somebody have some suggestions?

rna-seq • 652 views
ADD COMMENTlink written 19 months ago by ddzhangzz90
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1236 users visited in the last hour