Question: local blast and provide taxonomy to the querry
1
gravatar for shashank.gupta
3.1 years ago by
shashank.gupta10 wrote:

Hi,

I have a local database, and querry sequences (~500 sequences), I need to blast 500 sequences to local database and provide taxonomic information to all the 500 sequences.

Local database looks like -

>AB005893.1.1549 Bacteria;Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae;Lactobacillus;Lactobacillus collinoides TACGTAGGTGGCAAGCGTTGTAAAAAAATTT.....................
>AB005893.1.1549 Bacteria;Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae TACGTAGGTGGCAAGCGTTGTCCCCCCCC..........................

and so on...

and querry sequences -

>ABC_1
TACGTAGGTGGCAAGCGTTGTCCCCCCCC
>ABC_2
TACGTAGGTGGCAAGCGTTGTGGGGGG
>ABC_3
TACGTAGGTGGCAAGCGTTGTAAAAAAATTT

perform blast against a local database and similarity percentage minimum 97% and gives the taxonomy to query

Desirable output should be like -

>Bacteria;Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae
TACGTAGGTGGCAAGCGTTGTCCCCCCCC
>Bacteria;Firmicutes;Bacilli;Lactobacillales;Lactobacillaceae;Lactobacillus;Lactobacillus collinoides
TACGTAGGTGGCAAGCGTTGTAAAAAAATTT
sequencing blast alignment • 921 views
ADD COMMENTlink modified 3.1 years ago by genomax91k • written 3.1 years ago by shashank.gupta10

Do you've sequences from 16S data?

ADD REPLYlink written 3.1 years ago by Bioinformatics_NewComer320

Yes. this is from 16S data

ADD REPLYlink written 3.1 years ago by shashank.gupta10

Great. Why not use RDP classifier?

ADD REPLYlink written 3.1 years ago by Bioinformatics_NewComer320

I hope that works. thanks

ADD REPLYlink written 3.1 years ago by shashank.gupta10

You will have to parse your database fasta, after you get your blast results. So, for each query, grab the taxonomic information from the best matching db hit.

ADD REPLYlink written 3.1 years ago by st.ph.n2.5k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1492 users visited in the last hour