Consensus by aligning and extending the sequences
1
0
Entering edit mode
4.2 years ago
BDK_compbio ▴ 90

I am trying to align and extend some sequences to get a larger consensus sequence. Here is a toy example of my problem

 ACTTACTGTAGTAGA
           GTA-AGATGCGATGAGGAGAT-GAGAAATG
                GATG--ATGAGGAGATAGAGAAATGATTATA
  ----------------------------------------------
 ACTTACTGTAGTAGAGATGCGATGAGGAGATAGAGAAATGATTATA

I tried with different MSA tools, but most of them are trying to align the sequences from the first position. I am wondering if I am not aware of any tool that will solve my problem.

fasta msa alignment • 807 views
ADD COMMENT
0
Entering edit mode
4.2 years ago
h.mon 33k

Try CAP3, or GAP4 / GAP5.

ADD COMMENT
0
Entering edit mode

Thanks !! I will try them

ADD REPLY

Login before adding your answer.

Traffic: 2636 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6