Question: Consensus by aligning and extending the sequences
0
gravatar for sbdk82
10 weeks ago by
sbdk8230
United States
sbdk8230 wrote:

I am trying to align and extend some sequences to get a larger consensus sequence. Here is a toy example of my problem

 ACTTACTGTAGTAGA
           GTA-AGATGCGATGAGGAGAT-GAGAAATG
                GATG--ATGAGGAGATAGAGAAATGATTATA
  ----------------------------------------------
 ACTTACTGTAGTAGAGATGCGATGAGGAGATAGAGAAATGATTATA

I tried with different MSA tools, but most of them are trying to align the sequences from the first position. I am wondering if I am not aware of any tool that will solve my problem.

msa alignment fasta • 164 views
ADD COMMENTlink modified 10 weeks ago by h.mon9.2k • written 10 weeks ago by sbdk8230
0
gravatar for h.mon
10 weeks ago by
h.mon9.2k
Brazil
h.mon9.2k wrote:

Try CAP3, or GAP4 / GAP5.

ADD COMMENTlink written 10 weeks ago by h.mon9.2k

Thanks !! I will try them

ADD REPLYlink written 10 weeks ago by sbdk8230
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 691 users visited in the last hour