Question: SNPs; entrez utilities
0
gravatar for DK
18 months ago by
DK80
Canada
DK80 wrote:

enter code hereDear ALL,

I am trying to get all SNPs from the 5' and 3' UTRs of the RNAs of the genes "BRCA1". I found a way to get some information regarding this using entrez utilities: (If someone knows any other way to do this, please share with me. )

esearch -db gene -query "BRCA1" | elink -target snp | efetch -format xml

This gives me an xml file with rs entries like this below (this entry is for one rsID 864622723); In the following xml file output for rs id "864622723", could you please help me understand the doubts below:

<Rs rsId="**864622723**" snpClass="snp" snpType="notwithdrawn" molType="genomic" bitField="050060080A05000010020100" taxId="9606"><Validation/><Create build="146" date="2016-02-05 11:14"/        ><Update build="146" date="2017-02-06 13:30"/><Sequence exemplarSs="1966658404"><Seq5>AGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGC</Seq5><Observed>A/G</Observed><Seq3>TTCAGAAAGT        TAATGAGTGGTTTTCCAGAAGTGATGAACTGTTAGGTTCT</Seq3></Sequence><Ss ssId="1966658404" handle="CLINVAR" batchId="1062407" locSnpId="SCV000262150" subSnpClass="snp" orient="forward" strand="t        op" molType="genomic" buildId="146" methodClass="sequence" validated="by-submitter"><Sequence><Seq5>AGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGC</Seq5><Observed>A/G</Observed><S        eq3>TTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGATGAACTGTTAGGTTCT</Seq3></Sequence></Ss><Assembly dbSnpBuild="150" genomeBuild="38.3" groupLabel="GRCh38.p7" current="true" reference="true"><Comp        onent componentType="contig" accession="NT_010783.16" chromosome="17" start="26935980" end="81742541" orientation="fwd" gi="568802181" groupTerm="NC_000017.11" contigLabel="GCF_000001405.33"><MapLoc asnFrom="16158415" asnTo="16158415" locType="exact" alnQuality="1" orient="reverse" physMapInt="43094395" leftContigNeighborPos="16158414" rightContigNeighborPos="16158416" refAllele="T"><FxnSet geneId="672" symbol="BRCA1" mrnaAcc="NM_007294" mrnaVer="3" protAcc="NP_009225" protVer="1" fxnClass="missense" readingFrame="1" allele="G" residue="V" aaP        osition="378" soTerm="non_synonymous_codon"/><FxnSet geneId="672" symbol="BRCA1" mrnaAcc="NM_007294" mrnaVer="3" protAcc="NP_009225" protVer="1" fxnClass="reference" readingFrame="1"         allele="A" residue="I" aaPosition="378"/><FxnSet geneId="672" symbol="BRCA1" mrnaAcc="NM_007297" mrnaVer="3" protAcc="NP_009228" protVer="2" fxnClass="reference" readingFrame="1" alle        le="A" residue="I" aaPosition="331"/><FxnSet geneId="672" symbol="BRCA1" mrnaAcc="NM_007297" mrnaVer="3" protAcc="NP_009228" protVer="2" fxnClass="missense" readingFrame="1" allele="G        " residue="V" aaPosition="331" soTerm="non_synonymous_codon"/><FxnSet geneId="672" symbol="BRCA1" mrnaAcc="NM_007298" mrnaVer="3" fxnClass="intron-variant" soTerm="intron_variant"/><F        xnSet geneId="672" symbol="BRCA1" mrnaAcc="NM_007299" mrnaVer="3" fxnClass="intron-variant" soTerm="intron_variant"/><FxnSet geneId="672" symbol="BRCA1" mrnaAcc="NM_007300" mrnaVer="3        " protAcc="NP_009231" protVer="2" fxnClass="reference" readingFrame="1" allele="A" residue="I" aaPosition="378"/><FxnSet geneId="672" symbol="BRCA1" mrnaAcc="NM_007300" mrnaVer="3" pr        otAcc="NP_009231" protVer="2" fxnClass="missense" readingFrame="1" allele="G" residue="V" aaPosition="378" soTerm="non_synonymous_codon"/><FxnSet geneId="672" symbol="BRCA1" mrnaAcc="        NR_027676" mrnaVer="1" fxnClass="nc-transcript-variant" allele="-" soTerm="nc_transcript_variant"/><FxnSet geneId="672" symbol="BRCA1" mrnaAcc="U14680" mrnaVer="1" protAcc="AAA73985"         protVer="1" fxnClass="reference" readingFrame="1" allele="A" residue="I" aaPosition="378"/><FxnSet geneId="672" symbol="BRCA1" mrnaAcc="U14680" mrnaVer="1" protAcc="AAA73985" protVer=        "1" fxnClass="missense" readingFrame="1" allele="G" residue="V" aaPosition="378" soTerm="non_synonymous_codon"/></MapLoc></Component><SnpStat mapWeight="unique-in-contig" chromCount="        1" placedContigCount="1" unplacedContigCount="0" seqlocCount="1" hapCount="0"/></Assembly><PrimarySequence dbSnpBuild="150" gi="555931" source="hgvs" accession="U14680.1"><MapLoc asnF        rom="1253" asnTo="1253" locType="exact" alnQuality="1" orient="forward" leftContigNeighborPos="1252" rightContigNeighborPos="1254" refAllele="A"/></PrimarySequence><PrimarySequence db        SnpBuild="150" gi="237681118" source="hgvs" accession="NM_007300.3"><MapLoc asnFrom="1366" asnTo="1366" locType="exact" alnQuality="1" orient="forward" leftContigNeighborPos="1365" ri        ghtContigNeighborPos="1367" refAllele="A"/></PrimarySequence><PrimarySequence dbSnpBuild="150" gi="237681120" source="hgvs" accession="NM_007297.3"><MapLoc asnFrom="1274" asnTo="1274"         locType="exact" alnQuality="1" orient="forward" leftContigNeighborPos="1273" rightContigNeighborPos="1275" refAllele="A"/></PrimarySequence><PrimarySequence dbSnpBuild="150" gi="2376        81126" source="hgvs" accession="NR_027676.1"><MapLoc asnFrom="1270" asnTo="1270" locType="exact" alnQuality="1" orient="forward" leftContigNeighborPos="1269" rightContigNeighborPos="1        271" refAllele="A"/></PrimarySequence><PrimarySequence dbSnpBuild="150" gi="237757283" source="hgvs" accession="NM_007294.3"><MapLoc asnFrom="1366" asnTo="1366" locType="exact" alnQua        lity="1" orient="forward" leftContigNeighborPos="1365" rightContigNeighborPos="1367" refAllele="A"/></PrimarySequence><PrimarySequence dbSnpBuild="150" gi="262359905" source="hgvs" ac        cession="NG_005905.2"><MapLoc asnFrom="123587" asnTo="123587" locType="exact" alnQuality="1" orient="forward" leftContigNeighborPos="123586" rightContigNeighborPos="123588" refAllele=        "A"/></PrimarySequence><RsLinkout resourceId="1" linkValue="864622723"/><hgvs>AAA73985.1:p.Ile379Val</hgvs><hgvs>NC_000017.10:g.41246413T&gt;C</hgvs><hgvs>NC_000017.11:g.43094396T&gt;        C</hgvs><hgvs>NG_005905.2:g.123588A&gt;G</hgvs><hgvs>NM_007300.3:c.1135A&gt;G</hgvs><hgvs>NM_007297.3:c.994A&gt;G</hgvs><hgvs>NM_007298.3:c.787+348A&gt;G</hgvs><hgvs>NM_007299.3:c.787        +348A&gt;G</hgvs><hgvs>NM_007294.3:c.1135A&gt;G</hgvs><hgvs>NP_009228.2:p.Ile332Val</hgvs><hgvs>NP_009225.1:p.Ile379Val</hgvs><hgvs>NP_009231.2:p.Ile379Val</hgvs><hgvs>NR_027676.1:n.1        271A&gt;G</hgvs><hgvs>U14680.1:c.1135A&gt;G</hgvs><Phenotype><ClinicalSignificance>Uncertain significance</ClinicalSignificance></Phenotype></Rs>

a) Is "<seq5>AGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGC</seq5>" the 5' UTR? If not, can you please let me know in this entry which is the 5' UTR or how 5' UTR can be extracted?

b) Is "<seq3>TTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGATGAACTGTTAGGTTCT</seq3>" the 3' UTR? If not, can you please let me know in this entry which is the 3' UTR or how 3' UTR can be extracted??

c) In this entry, which allele(s) in 5' UTR is mutated to what allele, and at what position?

d) In this entry, which allele(s) in 3' UTR is mutated to what allele, and at what position?

This info will hep me to retrieve correct data for the respective rs number.

Thank you so much!

Regards, DK

snp • 544 views
ADD COMMENTlink modified 18 months ago • written 18 months ago by DK80

For some reason, the lines have gotten strikethrough. Pease ignore the strikethroughs and help me with your comments/solutions. Thanks

ADD REPLYlink written 18 months ago by DK80
1

I added markup to your post for increased readability and fixing the strikethrough problem. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below:

101010 Button

ADD REPLYlink written 18 months ago by WouterDeCoster37k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 904 users visited in the last hour