Question: Help to interpret results of kisSplice
0
gravatar for majeedaasim
2.2 years ago by
majeedaasim40
United States
majeedaasim40 wrote:

I am analysing the alternative splicing in my rna seq reads. NO reference genome is available. KIsSplice is adapted to this purpose.

I ran kissSplice on example data . I got the results folder containing many files. The user guide does not explain how to interpret the results, which is especially required for the naive non experts to this field. I got the the following files

type 1.fa

>bcc_1|Cycle_0|Type_1|upper_path_length_278|C1_0|C2_50|rank_1.00000
CGGACGCGCAAAATACAATAAAAAGGAAGGAAGAAAACGAAGTATCGCTATCTGCAAAGGCAGATCAAACTTGCTCGGCCAAATAAAAACACTTTGTAAATGAGTCTGAGCCACGCAGTTCGCTTGACAAGTTTTCCTCGGCTTGTCCAAAGAAAGTTGTAACAAATGTACATCAAATGAACAAGTTTTACCCAACACTTTCTCAGGCTAACAAATACTCTGCAGTTTCTGGCAGGGATACAGCGAGTGAGTGATCCCGCCATCATGAGCAAGAAGCC
>bcc_1|Cycle_0|Type_1|lower_path_length_82|C1_8|C2_0|rank_1.00000
CGGACGCGCAAAATACAATAAAAAGGAAGGAAGAAAACGAAATACAGCGAGTGAGTGATCCCGCCATCATGAGCAAGAAGCC

.edges file

0    1    RF
1    0    RF
1    2    RR
1    5    FR
2    3    RF
2    1    FF
3    2    RF
3    4    RR
4    5    RR
4    3    FF
5    1    FR
5    4    F

.nodes file

0    CAAAGAAAGTTGTAACAAATGTACATCAAATGAACAAGTTGTACCCAACACTTTCTCAGGCTAACAAATACTC
1    AACTTGTTCATTTGATGTACATTTGTTACAACTTTCTTTGGACAAGCCGAGGAAAACTTGTCAAGCGAACTGCGTGGCTCAGACTCATTTACAAAGTGTTTTTATTTGGCCGAGCAAGTTTGATCTGCCTTTGCAGATAGCGATACTTCGTTTTCTTCCTTCCTTTTTATTGTATTTTGCGCGTCC
2    GCTTCTTGCTCATGATGGCGGGATCACTCACTCGCTGTATCCCTGCCAGAAACTGCAGAGTATTTGTTAGCCTGAGAAAGTGTTGGGTAAAACTTGTTCATTTGATGTACATTTGTTACAACTTTCTTTG
3    ATACAGCGAGTGAGTGATCCCGCCATCATGAGCAAGAAGCCGACAGCCGGACCGGCGCTCCACAAGGTCATAATGGTGGGCAGTGGCGGCGTGGGAAAGTCCGCCCTCACACTGCAGTTTATGTACGATGAGTTCGTCGAGGACTACGAGCCCACCAAGGCCGATAGCTATAGGAAAAAGGTTGTGCTGGACGGCGAGGAAGTACAAATAGATATATTGGATACGGCTGGCCAGGAGGATTATGCCGCCATCAGAGATAACTACTTTCGCAGCGGCGAGGGTTTCCTTTGCGTCTTCTCCATCACAGACGACGAAAGCTTCCAGGCAACCCAGGAATTCAGAGAACAAATCTTGCGGGTGAAGAATGATGAGAGCATACCGTTCCTGCTGGTGGGCAACAAGTGCGATCTGAATGATAAGCGCAAGGTGCCGCTGAGCGAGTGCCAGCTGAGGGCGCAGCAGTGGGCGGTGCCCTATGTGGAGACCTCGGCTAAAACCCGCGAAAATGTGGACAAGGTATTTTTTGATTTGATGCGCGAAATAAGATCACGAAAAACCGAAGATTCGAAAGCCACGAGCGGGCGTGCTAAAGATAGATGCAAGAAGCGGAGACTTAAGTGTACCCTACTTTAGGCATTAGGTATTTTATGATCTAATCAGGGATATTTCATCGCGTAAAAAACAACGTCAGACGGACGTGAAACAGCCGCCGAAGCCCAACTCTCATTGCTGCCAACTGCTGTAGGATGATGAAGAACAACAACGGACAACAACCATACGATGAACAACAAAACAACTGCAGCAGCAACAAATTGGAAAATAACACAACGGCCACACGGATGATAACACCAACACACAGGATATGAAGGATATGGAGAACGGAACCATATGTTAATACAATTTAATTAATTAACTTTGAGAACACCAGTACACACATACGAACAGCAACAGATATTAAAACTATTTGCCACACTCAGAAACTCAAAATCCATAATCCACGTTAACTTTCATTGTAATATACATAAATATATATATATATATATATATGATTTAGGCAACAAGTTTTTTTTTCGAAAACATCAAGCGAAAAGCACACAGACGGGCAACTTACGAATTCTGTCGTTTATTTTTGGTTACTTATTTTTTTTTTTTTTTGAATCATCGATGTTTGTTTGTGTTGCCTCCGTAAAAAAAAAATGTTAAAACTAAAACCTAAAGCTGAAGCTAACGCTTAAACATATTAAATATAATCATCAATCGTAGACAACTAAAGAAGCCCATAATAATTATGCAATTTAAAACTTGCTACAGATATTTCTCTTGTTTAATTATATATACGCATACATTTTTTTGTAATATTTTTAAAGTTTAATAGCAAAATGCAAACCACACAAACCAACAAGAAACCACACAGAAAAGCTTTTTATAAATATATCTAAATATATATTTAAATATATATAAAATAGTATAAAACACTTAAAATCCTAGCGAAGAAACAACAGAGGAAAGCGGGGAGAAAGAAAAAACAGAAAAACAACAAATATCTCCAATTATTAATTGTAAACGAAGTGAATCGAAACAAATTTTTAATGCAATTTTTGTAATTTTCTAAACCGAAAGCAAATGTGTAGGGATTTATAAACAACAACAAAACCAATGAGTAATAATGGTACACACTAATGTTTCTGACAAGCTTTGGAGACTTTCCGTTACAAATAGTTATTTTCTTTGCCCTGGAACACATCCAATATATGTATATGTATGTATGTATGTATGTTTAGCAATTACTCCCGATTGATTTGCTTCTTTGTTTACTTTTGTATAACTGCATTCTGTATTGTAATATTTAAGCTATTATTATTATGATAATTATTATTATTATTAAATATATAAGTTATATATGCA
4    GGACGCGCAAAATACAATAAAAAGGAAGGAAGAAAACGAAATACAGCGAGTGAGTGATCCCGCCATCATGAGCAAGAAGC
5    CTTTCACACTAGTTTCTTTCAAGCAAGCAAAACCAACGGAACTTTAATTGCGGTGTGCGGCGAACGAGAAGAGAAACCGAAAAGCAGCCAATTTACTGTTGCGTTCCGATCCTGTTAATTCATCAGTTGCCGATTCTCCGATCGCGCCTGTAACTTTTTTGTTTAGTTTAGTGCATCAAGTGCGAGATAACACAGCAAAGCAACAACAAACGAAGCGACAGGCCAAAGCGGACGCGCAAAATACAATAAAAAGGAAGGAAGAAAACGAA

How can these results be interpreted? Is there any way way to graphically show these results.

thanks

ADD COMMENTlink modified 2.1 years ago by vincent.lacroix110 • written 2.2 years ago by majeedaasim40

Please use sensible tags for your question(s). At the very minimum, you should have added "kissplice". This enables developers to easily find questions about their tools. I have added this tag to your question now.

I also added markup to your post for increased readability. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below:

101010 Button

ADD REPLYlink written 2.2 years ago by WouterDeCoster42k
1
gravatar for vincent.lacroix
2.1 years ago by
vincent.lacroix110 wrote:

Dear user, The introductory slides we use in our trainings should help you. You can find them here: http://kissplice.prabi.fr/training/ Best regards, Vincent

ADD COMMENTlink written 2.1 years ago by vincent.lacroix110
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2284 users visited in the last hour