Question: Help to interpret results of kisSplice
0
gravatar for majeedaasim
10 months ago by
majeedaasim20
United States
majeedaasim20 wrote:

I am analysing the alternative splicing in my rna seq reads. NO reference genome is available. KIsSplice is adapted to this purpose.

I ran kissSplice on example data . I got the results folder containing many files. The user guide does not explain how to interpret the results, which is especially required for the naive non experts to this field. I got the the following files

type 1.fa

>bcc_1|Cycle_0|Type_1|upper_path_length_278|C1_0|C2_50|rank_1.00000
CGGACGCGCAAAATACAATAAAAAGGAAGGAAGAAAACGAAGTATCGCTATCTGCAAAGGCAGATCAAACTTGCTCGGCCAAATAAAAACACTTTGTAAATGAGTCTGAGCCACGCAGTTCGCTTGACAAGTTTTCCTCGGCTTGTCCAAAGAAAGTTGTAACAAATGTACATCAAATGAACAAGTTTTACCCAACACTTTCTCAGGCTAACAAATACTCTGCAGTTTCTGGCAGGGATACAGCGAGTGAGTGATCCCGCCATCATGAGCAAGAAGCC
>bcc_1|Cycle_0|Type_1|lower_path_length_82|C1_8|C2_0|rank_1.00000
CGGACGCGCAAAATACAATAAAAAGGAAGGAAGAAAACGAAATACAGCGAGTGAGTGATCCCGCCATCATGAGCAAGAAGCC

.edges file

0    1    RF
1    0    RF
1    2    RR
1    5    FR
2    3    RF
2    1    FF
3    2    RF
3    4    RR
4    5    RR
4    3    FF
5    1    FR
5    4    F

.nodes file

0    CAAAGAAAGTTGTAACAAATGTACATCAAATGAACAAGTTGTACCCAACACTTTCTCAGGCTAACAAATACTC
1    AACTTGTTCATTTGATGTACATTTGTTACAACTTTCTTTGGACAAGCCGAGGAAAACTTGTCAAGCGAACTGCGTGGCTCAGACTCATTTACAAAGTGTTTTTATTTGGCCGAGCAAGTTTGATCTGCCTTTGCAGATAGCGATACTTCGTTTTCTTCCTTCCTTTTTATTGTATTTTGCGCGTCC
2    GCTTCTTGCTCATGATGGCGGGATCACTCACTCGCTGTATCCCTGCCAGAAACTGCAGAGTATTTGTTAGCCTGAGAAAGTGTTGGGTAAAACTTGTTCATTTGATGTACATTTGTTACAACTTTCTTTG
3    ATACAGCGAGTGAGTGATCCCGCCATCATGAGCAAGAAGCCGACAGCCGGACCGGCGCTCCACAAGGTCATAATGGTGGGCAGTGGCGGCGTGGGAAAGTCCGCCCTCACACTGCAGTTTATGTACGATGAGTTCGTCGAGGACTACGAGCCCACCAAGGCCGATAGCTATAGGAAAAAGGTTGTGCTGGACGGCGAGGAAGTACAAATAGATATATTGGATACGGCTGGCCAGGAGGATTATGCCGCCATCAGAGATAACTACTTTCGCAGCGGCGAGGGTTTCCTTTGCGTCTTCTCCATCACAGACGACGAAAGCTTCCAGGCAACCCAGGAATTCAGAGAACAAATCTTGCGGGTGAAGAATGATGAGAGCATACCGTTCCTGCTGGTGGGCAACAAGTGCGATCTGAATGATAAGCGCAAGGTGCCGCTGAGCGAGTGCCAGCTGAGGGCGCAGCAGTGGGCGGTGCCCTATGTGGAGACCTCGGCTAAAACCCGCGAAAATGTGGACAAGGTATTTTTTGATTTGATGCGCGAAATAAGATCACGAAAAACCGAAGATTCGAAAGCCACGAGCGGGCGTGCTAAAGATAGATGCAAGAAGCGGAGACTTAAGTGTACCCTACTTTAGGCATTAGGTATTTTATGATCTAATCAGGGATATTTCATCGCGTAAAAAACAACGTCAGACGGACGTGAAACAGCCGCCGAAGCCCAACTCTCATTGCTGCCAACTGCTGTAGGATGATGAAGAACAACAACGGACAACAACCATACGATGAACAACAAAACAACTGCAGCAGCAACAAATTGGAAAATAACACAACGGCCACACGGATGATAACACCAACACACAGGATATGAAGGATATGGAGAACGGAACCATATGTTAATACAATTTAATTAATTAACTTTGAGAACACCAGTACACACATACGAACAGCAACAGATATTAAAACTATTTGCCACACTCAGAAACTCAAAATCCATAATCCACGTTAACTTTCATTGTAATATACATAAATATATATATATATATATATATGATTTAGGCAACAAGTTTTTTTTTCGAAAACATCAAGCGAAAAGCACACAGACGGGCAACTTACGAATTCTGTCGTTTATTTTTGGTTACTTATTTTTTTTTTTTTTTGAATCATCGATGTTTGTTTGTGTTGCCTCCGTAAAAAAAAAATGTTAAAACTAAAACCTAAAGCTGAAGCTAACGCTTAAACATATTAAATATAATCATCAATCGTAGACAACTAAAGAAGCCCATAATAATTATGCAATTTAAAACTTGCTACAGATATTTCTCTTGTTTAATTATATATACGCATACATTTTTTTGTAATATTTTTAAAGTTTAATAGCAAAATGCAAACCACACAAACCAACAAGAAACCACACAGAAAAGCTTTTTATAAATATATCTAAATATATATTTAAATATATATAAAATAGTATAAAACACTTAAAATCCTAGCGAAGAAACAACAGAGGAAAGCGGGGAGAAAGAAAAAACAGAAAAACAACAAATATCTCCAATTATTAATTGTAAACGAAGTGAATCGAAACAAATTTTTAATGCAATTTTTGTAATTTTCTAAACCGAAAGCAAATGTGTAGGGATTTATAAACAACAACAAAACCAATGAGTAATAATGGTACACACTAATGTTTCTGACAAGCTTTGGAGACTTTCCGTTACAAATAGTTATTTTCTTTGCCCTGGAACACATCCAATATATGTATATGTATGTATGTATGTATGTTTAGCAATTACTCCCGATTGATTTGCTTCTTTGTTTACTTTTGTATAACTGCATTCTGTATTGTAATATTTAAGCTATTATTATTATGATAATTATTATTATTATTAAATATATAAGTTATATATGCA
4    GGACGCGCAAAATACAATAAAAAGGAAGGAAGAAAACGAAATACAGCGAGTGAGTGATCCCGCCATCATGAGCAAGAAGC
5    CTTTCACACTAGTTTCTTTCAAGCAAGCAAAACCAACGGAACTTTAATTGCGGTGTGCGGCGAACGAGAAGAGAAACCGAAAAGCAGCCAATTTACTGTTGCGTTCCGATCCTGTTAATTCATCAGTTGCCGATTCTCCGATCGCGCCTGTAACTTTTTTGTTTAGTTTAGTGCATCAAGTGCGAGATAACACAGCAAAGCAACAACAAACGAAGCGACAGGCCAAAGCGGACGCGCAAAATACAATAAAAAGGAAGGAAGAAAACGAA

How can these results be interpreted? Is there any way way to graphically show these results.

thanks

ADD COMMENTlink modified 9 months ago by vincent.lacroix80 • written 10 months ago by majeedaasim20

Please use sensible tags for your question(s). At the very minimum, you should have added "kissplice". This enables developers to easily find questions about their tools. I have added this tag to your question now.

I also added markup to your post for increased readability. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below:

101010 Button

ADD REPLYlink written 10 months ago by WouterDeCoster30k
1
gravatar for vincent.lacroix
9 months ago by
vincent.lacroix80 wrote:

Dear user, The introductory slides we use in our trainings should help you. You can find them here: http://kissplice.prabi.fr/training/ Best regards, Vincent

ADD COMMENTlink written 9 months ago by vincent.lacroix80
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1660 users visited in the last hour