Entering edit mode
6.6 years ago
HK
▴
40
Hey,
I am running an RNA seq pipeline, all my samples gave the output after mapping except one and it gives an error:
prep_reads v2.1.1 (ecf7617)
---------------------------
Error: qual length (76) differs from seq length (45) for fastq record !
gzip: stdout: Broken pipe
Stange that all the other worked perfectly. Then i tried fastqc to check the quality and it shopped at 65% and gave the error:
Approx 55% complete for 102842-001-042_R1.fastq.gz
Approx 60% complete for 102842-001-042_R1.fastq.gz
Approx 65% complete for 102842-001-042_R1.fastq.gz
Failed to process file 102842-001-042_R1.fastq.gz
uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Midline 'GACTGATTCGTCTGG AGTTACCATTCCCTGTGGCTC' didn't start with '+'
at uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:172)
at uk.ac.babraham.FastQC.Sequence.FastQFile.next(FastQFile.java:125)
at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java :76)
at java.lang.Thread.run(Thread.java:701)
Now i am clueless, what to do. I did not do any trimming as all the pre-processing was done my the company who gave the sequencing samples.
Well i didnt do any pre processing myself. I got the pre-processed files and have to do the mapping and stuff. Now, in such a case having different sequence and quality length for the same read what should i do, should i remove such read and how?
Removing the read might solve this, but you remove the symptom and not the cause.
Something went wrong when that file was created. It's corrupted. Your best bet is to get access to the original data.