Should I remove all the overrepresented sequences to improve GC content in fastqc?
Entering edit mode
4.5 years ago
Lila M ★ 1.1k

Hi everybody, I've just get some RNA-seq (single end) that I have to analyze. As always, I first did the QC with fastqc but I was very surprising because Per base content and per sequence GC content fails. I also have a warning for seq duplication levels (65 overrepresented sequences) :

GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC  23847   0.1957340853094293  TruSeq Adapter, Index 2 (100% over 50bp)

I think if I remove all the overrepresented sequences I will improve the Per sequence GC content, but not sure if is the best option... any suggestion or advice?


fastqc RNA-Seq single-end overrepresented • 4.1k views
Entering edit mode

In general, it is generally a good idea to try to figure out why you see the overrepresented sequences before removing them.

Entering edit mode

Apparently the run did overcluster due to library concentration... so in that case what is the best choice?

Entering edit mode

Is this NextSeq data? "Failing" a test does not automatically make the data bad. If those are bad basecalls due to run overclustering then you would get a lower fraction of reads aligning.

My suggestion is don't mess with the data beyond scanning for and getting rid of adapters/extraneous sequences. If the downstream analysis demonstrates a problem then you can backtrack to diagnose other issues.

Entering edit mode

Yes, is NextSeq data. Only one index has been reported in overrepresented sequences but adapter content pass (flat). However, lot of kmers has been reported. So I will do the alignment and run multiqc and see whats going on. Thanks!

Entering edit mode

Don't depend on FastQC to judge adapter contamination. It does not look at the entire data when reporting various stats (see below). Use a proper scan/trim program like from BBMap.

  • Duplication module and overrepresented sequences module track the first 8000 sequences it sees (but then reads them to the end of the file), the amount of data this represents will vary per file.
  • Per tile plot only tracks 10% of the data (1 in 10 sequences)
  • k-mer module only tracks 2% of the data (1 in 50 sequences)
Entering edit mode

So I can't figure out how to scan and trim my fastq file with, as is necessary to tell the sequences or kmers that I want to remove and they only appeared in fastqc report... maybe I miss something? thanks

Entering edit mode

Idea is you are not going to remove anything other than Illumina adapters, that is if they are present. If your data has really bad quality (Q10 or less) then and only then you may want to do quality based trimming/filtering (trimq=10). Otherwise something like this should suffice.

If you have PE data in1=file_R1.fq.gz in2=file_R2.fq.gz out1=clean_R1.fq.gz out2=clean_R2.fq.gz ktrim=r k=21 path=/path_to/bbmap/resources/adapters.fa tbo tpe

If your data is single-end in1=file.fq.gz out=clean.fq.gz ktrim=r k=21 path=/path_to/bbmap/resources/adapters.fa

Once this is done, don't worry about fastqc. Just proceed with your analysis. should produce nice stats at the end of the run. Post then here if you want a second opinion.

Entering edit mode

thank you very much for the info! Very useful!

Entering edit mode

Other naive question.... should I use also the ? thanks!

Entering edit mode

Not unless you have Nextera long mate pair libraries. Do you?

Entering edit mode

No for that pool of sequences, but I will have to analyze some DNA paired end with Nextera long mate pair libraries.

Entering edit mode

Then yes. See the guide in bbmap/docs/guides/SplitNexteraGuide.txt for that.


Login before adding your answer.

Traffic: 1402 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6