Question: fastq quality scores
0
gravatar for nukkduko
2.2 years ago by
nukkduko0
nukkduko0 wrote:

Hello everyone! I'm a little bit confused with fastq quality score. I've got fastq with reads like this:

@EAS18:1:1:2:1642:1830:0/2
TGTCCCATCTCATGCTCAAGCAGCAGACGAAC
+
a`_^a_^a_aa^aa`a_`_a[[a^_aU__W^^Xa````^_`RER

What is phred quality score for first nucleotide? It's "a", but there is no small "a" in The Table: The Table

All that I know is that this score must be less or equal than 40.

fastq • 3.5k views
ADD COMMENTlink modified 2.2 years ago by Pierre Lindenbaum128k • written 2.2 years ago by nukkduko0
2
gravatar for cschu181
2.2 years ago by
cschu1812.3k
cschu1812.3k wrote:

You're looking at a Phred33 table, but your read looks as if it might have a different encoding (Phred64): https://en.wikipedia.org/wiki/FASTQ_format.

ADD COMMENTlink written 2.2 years ago by cschu1812.3k

Yes, thanks for your help. With that table it works: Good for me table

ADD REPLYlink written 2.2 years ago by nukkduko0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1027 users visited in the last hour