Question: fastq quality scores
0
gravatar for nukkduko
12 months ago by
nukkduko0
nukkduko0 wrote:

Hello everyone! I'm a little bit confused with fastq quality score. I've got fastq with reads like this:

@EAS18:1:1:2:1642:1830:0/2
TGTCCCATCTCATGCTCAAGCAGCAGACGAAC
+
a`_^a_^a_aa^aa`a_`_a[[a^_aU__W^^Xa````^_`RER

What is phred quality score for first nucleotide? It's "a", but there is no small "a" in The Table: The Table

All that I know is that this score must be less or equal than 40.

fastq • 1.5k views
ADD COMMENTlink modified 12 months ago by Pierre Lindenbaum118k • written 12 months ago by nukkduko0
2
gravatar for cschu181
12 months ago by
cschu1811.5k
cschu1811.5k wrote:

You're looking at a Phred33 table, but your read looks as if it might have a different encoding (Phred64): https://en.wikipedia.org/wiki/FASTQ_format.

ADD COMMENTlink written 12 months ago by cschu1811.5k

Yes, thanks for your help. With that table it works: Good for me table

ADD REPLYlink written 12 months ago by nukkduko0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1036 users visited in the last hour