Question: Align and print steam-loop
0
gravatar for sacha
2.9 years ago by
sacha2.0k
France
sacha2.0k wrote:

Hi,

Do you know which tool to use to generate and print stem-loop from from a short sequence ?

For instance, using the following mir sequence:

>hsa-mir-7106 MI0022957
GCUUCUGGGAGGAGGGGAUCUUGGGAGUGAUCCCAACAGCUGAGCUCCCUGAAUCCCUGUCCCAG

I would like to print the following alignement

   gcuu      gga      cuu      gauccc 
5'     cuggga   ggggau   gggagu      a
       ||||||   ||||||   ||||||      a
3'     gacccu   ucccua   cccucg      c
   ----      --g      agu      agucga
mir alignment loop • 583 views
ADD COMMENTlink modified 2.9 years ago • written 2.9 years ago by sacha2.0k
2
gravatar for Pierre Lindenbaum
2.9 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum133k wrote:

RNA fold ? http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi

ADD COMMENTlink written 2.9 years ago by Pierre Lindenbaum133k

That's perfect ! Thanks for the quick answer

ADD REPLYlink written 2.9 years ago by sacha2.0k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2262 users visited in the last hour
_