Question: sRNAbench warnings during novel miRNA identification
gravatar for tesic93
11 days ago by
tesic9310 wrote:


While running novel miRNA identification with sRNAbench on this file with parameters

dbPath=sRNAtoolboxDB input=/path_to_file/ERR187516.fastq.gz output=sRNAtoolboxDB/out/ERR187516_miR microRNA=hsa species=ucsc.hg19 p=4 adapter=TGGAATTCTCGGGTGCCAAGGAACTC adapterMinLength=6 adapterMM=1 minRC=2 mm=0 alignType=v predict=true

these warnings pop up:

WARNING: The results will be FALSE if these sequences are spliced!! hairpin

Is this just a general warning that says that hairpins that originate from intronic parts of the host gene during splicing can not be properly aligned? Or does it mean something completely different?

WARNING: The coordinates of the theoretical star sequence are out of range! (start < 1)null

This warning pops up 3 times with this files, but for different input files the number of occurrences is different. What does it mean exactly? And is it a problem that this pops up? Or is it just a reason it discards several reads which happens often?

Basically, I'm interested if it is a problem that I have these warnings, or are they a regular thing which pops up often?



ADD COMMENTlink modified 3 days ago • written 11 days ago by tesic9310
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 792 users visited in the last hour