Question: extraction of the 16s rRNA gene from a file containing the genome
0
gravatar for ulises.rodriguez
10 months ago by
ulises.rodriguez0 wrote:

Hello everyone, I have a fasta files containing genomes of bacterias and I would like to extract only 16s rRNA gene, I have tried with R packages like "micropan" with the function barrnap using the following code barrnap(genome.file = "file_containing_genome.fasta",bacteria = T,cpu = 8) and the output is the next

Seqid Source Type Start End Score Strand Phase Attributes NC_009925 barrnap:0.7 rRNA 1405563 1405673 4.2e-09 - NA Name=5S_rRNA;product=5S ribosomal RNA NC_009925 barrnap:0.7 rRNA 1409150 1410649 0.0e+00 - NA Name=16S_rRNA;product=16S ribosomal RNA NC_009925 barrnap:0.7 rRNA 5636176 5637675 0.0e+00 + NA Name=16S_rRNA;product=16S ribosomal RNA NC_009925 barrnap:0.7 rRNA 5641152 5641262 4.2e-09 + NA Name=5S_rRNA;product=5S ribosomal RNA

Is there a way to extract the gene with the position provided from this function? or Is there another way to extract this gene?

sequence gene genome • 570 views
ADD COMMENTlink modified 9 months ago by sacha1.7k • written 10 months ago by ulises.rodriguez0
1
gravatar for sacha
9 months ago by
sacha1.7k
France
sacha1.7k wrote:

I'll recommend you to do in sillico PCR using constant region primers of 16S gene. For instance :

  • 8F : AGAGTTTGATCCTGGCTCAG
  • 1492R : CGGTTACCTTGTTACGACTT

For this purpose, you can use cutadapt ( see my solution ) or this tools https://github.com/simonrharris/in_silico_pcr (not tested)

http://help.bioiplug.com/16s-rrna-and-16s-rrna-gene/

enter image description here

ADD COMMENTlink modified 9 months ago • written 9 months ago by sacha1.7k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 934 users visited in the last hour