Question: Trimming reads of Chipseq samples
0
gravatar for GK1610
9 months ago by
GK161060
United States
GK161060 wrote:

I am using trimmomatic to trim out the adaptor sequences from chip-seq fastq files. I tried Adaptor 1 (TruSeq3-PE-2.fa) file which is default in trimmomatic software and I get 95.77% of both survived reads whereas when I use the adaptor file (A2 see below) with overrepresented sequences I get 80.45% of BothSurviving reads. The dropped pct is ~ 1% in both cases and fastqc for both samples show < .04% of adaptor content. 4% of overrepresented sequences comes out for Sample_001.with adaptorA1.fastq.gz whereas no overrepresented sequences in Sample_001.with adaptorA2.fastq.gz

My question is, when I run the alignment later, is it gonna make it worse by have less % of both surviving reads or when call peaks later I will get less peaks? Which one I should go for?

Filename    InputReadPairs  BothSurviving   ForwardOnlySurviving    ReverseOnlySurviving    Dropped
Sample_001.with **adaptorA1**.fastq.gz  101005952   96732909 (95.77%)   2347954 (2.32%) 1332466 (1.32%) 592623 (0.59%)
Sample_001.with **adaptorA2**.fastq.gz  101005952   81260458 (80.45%)   1564086 (1.55%) 16804902 (16.64%)   1376506 (1.36%)

Adaptor 1:TruSeq3-PE.fa

>PrefixPE/1
TACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PrefixPE/2
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

Adaptor 2:TruSeq3-PE.fa with overrepresented sequence

>PrefixPE/1
TACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PrefixPE/2
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>TruSeqAdapterIndex1
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex2
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex3
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex4
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex5
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex6
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex7
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex8
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex9
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex10
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex11
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex12
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG
chip-seq alignment • 341 views
ADD COMMENTlink modified 9 months ago by Devon Ryan88k • written 9 months ago by GK161060
1

If the data that is being trimmed is adapter sequence, it does not belong to your samples and should not be there when you do the analysis anyway.

ADD REPLYlink written 9 months ago by genomax64k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1163 users visited in the last hour