Adapter Removal - Nextera LIbrary
0
0
Entering edit mode
3.0 years ago
ailinleti • 0

Hi folks,

I'm trying to start to analyze my single-cell-RNA-seq data. Library was made using Single cell Smart-Seq2 and Nextera XT library prep. After asking the facility which adapter sequences I should remove they reply saying:

nextera_adapter=“CTGTCTCTTATA” - reads trimmed with 3’ trimming unto this sequence (not reverse complement or anything else).

illumP7PCR_adapter=“ATCTCGTATGCCGTCTTCTGCTTG” - reads trimmed with 3’ trimming unto this sequence (not reverse complement or anything else).

smarter_adapter=“TGGTATCAACGCAGAGTAC” - reads trimmed with 5’ trimming unto this sequence (not reverse complement or anything else).

I'm a bit confused as for PE reads I would exect only two sequences to remove, and I don't know of any software that could do the job for 3 adapter sequences together.

I would really appreciate any feedback on this.

Best,

ailinleti.

RNA-Seq rna-seq • 2.5k views
ADD COMMENT
0
Entering edit mode

Trimming software programs (e.g. bbduk.sh/trimmomatic etc) can trim any number of adapters at the same time. In fact bbduk.sh includes adapters.fa in resources directory which has most of the common illumina adapters in it. You can edit that file and any additional sequences you want in it). You can also use literal=seq1,seq2,seq3 .. with bbduk.sh to provide sequences on the command line that will be used for scan/trim.

ADD REPLY
0
Entering edit mode

You can use cutadapt with multiple -a and -A flags

ADD REPLY

Login before adding your answer.

Traffic: 1004 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6