Adapter Removal - Nextera LIbrary

Question

[ailinleti]

Hi folks,

I'm trying to start to analyze my single-cell-RNA-seq data. Library was made using Single cell Smart-Seq2 and Nextera XT library prep. After asking the facility which adapter sequences I should remove they reply saying:

nextera_adapter=“CTGTCTCTTATA” - reads trimmed with 3’ trimming unto this sequence (not reverse complement or anything else).

illumP7PCR_adapter=“ATCTCGTATGCCGTCTTCTGCTTG” - reads trimmed with 3’ trimming unto this sequence (not reverse complement or anything else).

smarter_adapter=“TGGTATCAACGCAGAGTAC” - reads trimmed with 5’ trimming unto this sequence (not reverse complement or anything else).

I'm a bit confused as for PE reads I would exect only two sequences to remove, and I don't know of any software that could do the job for 3 adapter sequences together.

I would really appreciate any feedback on this.

Best,

ailinleti.

[GenoMax]

Trimming software programs (e.g. bbduk.sh/trimmomatic etc) can trim any number of adapters at the same time. In fact bbduk.sh includes adapters.fa in resources directory which has most of the common illumina adapters in it. You can edit that file and any additional sequences you want in it). You can also use literal=seq1,seq2,seq3 .. with bbduk.sh to provide sequences on the command line that will be used for scan/trim.

[Asaf]

You can use cutadapt with multiple -a and -A flags