Question: Exonerate output handling/settingup
0
gravatar for tim.ivanov.92
3 months ago by
tim.ivanov.920 wrote:

I'm trying to get maximum from exonerate aligner tool: i would like to be able to extract alignments produced automatically and be able to parse it in any way. For example - i want to know whether start/end of query/subject sequence is aligned or not.

my code is like

from Bio import SearchIO
fname = 'my_output.out'
qresult = list(SearchIO.parse(fname, 'exonerate-text'))
first_query = qresult[0]
second_query = qresult[1]
#print qresult[0].fragments[0].query.seq
print qresult[0].fragments[0]

which prints smthing like

Query: my_query_name 
Hit: XM_015159452.1 Drosophila erecta uncharacterized protein, transc...
Query range: [0:371] (1)
Hit range: [3116:3487] (1)
Fragments: 1 (371 columns)
     Query - CTCCGTTACATCCGCTGATAGTTTAATGGGCGGAGGAGGAAGTCTTCGCCGGCGAACTA~~~CCAAG
              || |||||||| ||||||||||| |||||||||||||||||||| ||||||||||| |~~~|||||
       Hit - TTCGGTTACATCTGCTGATAGTTTGATGGGCGGAGGAGGAAGTCTCCGCCGGCGAACAA~~~CCAAG

Is there a way to just output ALL the alignment? if i need to check some stats about it?

biopython alignment exonerate • 128 views
ADD COMMENTlink written 3 months ago by tim.ivanov.920

Exonerate has hundreds of settings, you have to tweak how you run it - you want to run it with global alignment option, like --model affine:global.

ADD REPLYlink written 3 months ago by h.mon21k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 766 users visited in the last hour