how to get circRNA fasta sequence from CIRI bed
1
1
Entering edit mode
2.7 years ago
fanyucai1 ▴ 10

hello everyone, i use the CIRI to get the bed file of circRNA.

But how can i get the circRNA sequence?

I try to use find_circ,but could only get the spliced reads.

what should i do?

circRNA analysis • 1.1k views
ADD COMMENT
0
Entering edit mode
2.7 years ago

BEDTools getfasta

You can use BEDTools getFasta:

cat test.bed 
5   1000000 1000500
9   5000    6000

bedtools getfasta -fi 1000Genomes/human_g1k_v37.fasta -bed test.bed -fo test.fasta

cat test.fasta 
>5:1000000-1000500
GTTTTAACTAAACTAACTCCCCAAAAACTGGACACGTGACTTCACGAGGCTTTTGCCGAGGAGCCCTGGGCTGCAGGGAACATTAATGGGGTAGGTGCACCCAGGCAAGGATGTGGGCAGACCCTCCAGCCTCTTGTGGTCTGGGTGTGCCTTGGGAAATGGCCAGCAGGATTCTTCTTGGAGGCAAGCTGGAGATTTTTAGGTCCTGGGTTAGAGGGAGAACTATGCGATTCCTCTGAGAGACCTGGGGATGGAGGGACTGGACCCTTCCAGCCACCTGTGCTGAGCCCATCTGCTGCCTCCTAAGGGGCTCCTAAGGGGCAATGGGTGGAAGTCTCCTGGGCTATGCCCTGAGCAGACACCATCCTTTTTGCTCCTTGGCAAAGATGCCTCTCAGGATCAAAGACCTGGTGGCCTGGTCCCTCCAGGAGGAATGGGAGGGCCAGCTTCCTTCCCTGACAGCTATGGGAAGATGGAACCCAGTCCAGGCCTTGAGTGCA
>9:5000-6000
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

gffread

gffread, from Cufflinks / StringTie, is another option and it can output coding or non-coding strand sequence. I go over this, here: A: Cufflinks gffread utility

Kevin

ADD COMMENT

Login before adding your answer.

Traffic: 1608 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6