Question: how to get circRNA fasta sequence from CIRI bed
0
gravatar for fanyucai1
2.3 years ago by
fanyucai10
fanyucai10 wrote:

hello everyone, i use the CIRI to get the bed file of circRNA.

But how can i get the circRNA sequence?

I try to use find_circ,but could only get the spliced reads.

what should i do?

circrna analysis • 885 views
ADD COMMENTlink modified 2.3 years ago by Kevin Blighe67k • written 2.3 years ago by fanyucai10
0
gravatar for Kevin Blighe
2.3 years ago by
Kevin Blighe67k
Republic of Ireland
Kevin Blighe67k wrote:

BEDTools getfasta

You can use BEDTools getFasta:

cat test.bed 
5   1000000 1000500
9   5000    6000

bedtools getfasta -fi 1000Genomes/human_g1k_v37.fasta -bed test.bed -fo test.fasta

cat test.fasta 
>5:1000000-1000500
GTTTTAACTAAACTAACTCCCCAAAAACTGGACACGTGACTTCACGAGGCTTTTGCCGAGGAGCCCTGGGCTGCAGGGAACATTAATGGGGTAGGTGCACCCAGGCAAGGATGTGGGCAGACCCTCCAGCCTCTTGTGGTCTGGGTGTGCCTTGGGAAATGGCCAGCAGGATTCTTCTTGGAGGCAAGCTGGAGATTTTTAGGTCCTGGGTTAGAGGGAGAACTATGCGATTCCTCTGAGAGACCTGGGGATGGAGGGACTGGACCCTTCCAGCCACCTGTGCTGAGCCCATCTGCTGCCTCCTAAGGGGCTCCTAAGGGGCAATGGGTGGAAGTCTCCTGGGCTATGCCCTGAGCAGACACCATCCTTTTTGCTCCTTGGCAAAGATGCCTCTCAGGATCAAAGACCTGGTGGCCTGGTCCCTCCAGGAGGAATGGGAGGGCCAGCTTCCTTCCCTGACAGCTATGGGAAGATGGAACCCAGTCCAGGCCTTGAGTGCA
>9:5000-6000
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

gffread

gffread, from Cufflinks / StringTie, is another option and it can output coding or non-coding strand sequence. I go over this, here: A: Cufflinks gffread utility

Kevin

ADD COMMENTlink written 2.3 years ago by Kevin Blighe67k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1867 users visited in the last hour