Question: BWA alignment query
0
gravatar for chirag.agrawal.91
10 weeks ago by
chirag.agrawal.910 wrote:

I am new to gene alignment. I am trying to align few short/long reads with a reference genome using bwa software. I have been following this tutorial - https://icb.med.cornell.edu/wiki/index.php/Elementolab/BWA_tutorial

I did the following -

  • Downloaded bwa-0.5.9.tar.bz2 and build.
  • Downloaded reference human genome as wg.fa
  • Created bwt index using - bwa index -p hg19bwaidx -a bwtsw wg.fa.
  • Try and align long reads from 454seqs.txt - bwa bwasw hg19bwaidx 454seqs.txt > 454seqs.sam

The output (SAM format) file of alignment only has the header information and no alignment information. Can someone guide me if I am missing something. Also, what would be the next steps in your opinion to play around with this software to get a better understanding of the run times for alignment.

bwa alignment • 154 views
ADD COMMENTlink modified 10 weeks ago by swbarnes24.6k • written 10 weeks ago by chirag.agrawal.910
1
gravatar for swbarnes2
10 weeks ago by
swbarnes24.6k
United States
swbarnes24.6k wrote:

Since you got a sam file, bwa is probably installed and working properly. I'd check to be sure that your reference file isn't empty, that your fastq file isn't empty, and that your sam file really is header all the way to the end.

I also wouldn't play around much with bwa version 0.5.9, because it is ancient.

ADD COMMENTlink written 10 weeks ago by swbarnes24.6k

Hi swbarnes2, Thanks for your answer. Here are my comments on your observations

  1. My reference file is not empty.
  2. I thought the reference file (wg.fa) is the FASTA file I am using. I don't understand which is the FASTQ file you're referring to.
  3. The sam file looks something like this @SQ SN:chr10 LN:135534747 @SQ SN:chr11 LN:135006516 @SQ SN:chr11_gl000202_random LN:40103 . . . @SQ SN:chrX LN:155270560 @SQ SN:chrY LN:59373566 @PG ID:bwa PN:bwa VN:0.7.17-r1188 CL:bwa samse hg19bwaidx 454seqs.txt.bwa 454seqs.txt

  4. I am sorry the version I am using is bwa-0.7.17. Can you shed some light on this version.

ADD REPLYlink modified 10 weeks ago • written 10 weeks ago by chirag.agrawal.910

Hi, I was able to resolve the issue.

My long reads file looked something like this before - >read1_2079_205 AGTCTCCCTCTTTGTCTCTCCCATTGACTCAGCTTTCTATGGCCTCAGATTCCCCATCCCCTTCCCAACGCCCCAGCACTGGAAGACACGTGCTGTCCCTGGTGCCGGCTCCTACGGCTAGGTCGTGGCTGGCCAGGAAATCCCCCTGGTTGGCTATGCCCCCGCTGCTCCCCCCCGCGATTACCTCCCCGGGCGCGTGCGCAAT

I had to replace > with > for it to work.

ADD REPLYlink modified 10 weeks ago • written 10 weeks ago by chirag.agrawal.910
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1474 users visited in the last hour