Question: Is BWA consider insert size when define read mapped in proper pair
0
gravatar for Medhat
4 months ago by
Medhat8.2k
Texas
Medhat8.2k wrote:

When BWA assign flag 2 for read mapped in proper pair Does it take in consideration the insert size? (from searching I think yes), But in the read below I see that the insert size is 6.
So what define proper insert size? Is't small value of insert size could point to a potential deletion? (like the case below)

HISEQ1:19:H8VDAADXX:2:2106:8906:10302 99 1 7559182 30 57M4I75M4D12M = 7559060 6 GGTGTGATCCTGGTGTGCGTGTGTACGTATATGAGTGTGTGTGTGCATGTGTGTCCATGAGTGAGTGTGCAGAGAGGATGGTGTGATCCTGGTGTGCATGTGTATGTATTTGAGTGTGTGTGTGCATGTGTGTACATGAGTGTGTAGA @BBFDDFFHHHHHJIIJJJIJIIIJJJIJJJJJIJGGHHGHHIHIJIJJIIIJJJJJJJIIBFCHFHEHBHIHHHHFDFBC>ACDDDCCCCD;<?BCCCA>@5;@C:>>@CD4<:@@A<A<?AA>ADCDDDBDCDDCC:@CCCC2>>3 NM:i:9 MD:Z:105A26^TGAG12 MC:Z:26S18M6D104M AS:i:123 XS:i:108 XA:Z:1,+7559103,148M,9; RG:Z:sample_3

sequencing bwa alignment • 199 views
ADD COMMENTlink modified 4 months ago by Pierre Lindenbaum117k • written 4 months ago by Medhat8.2k
1
gravatar for Pierre Lindenbaum
4 months ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum117k wrote:

if I'm not wrong for each batch of fastq data, bwa use a percentile of the read-length distribution. see:

https://github.com/lh3/bwa/blob/master/bwamem_pair.c#L84

https://github.com/lh3/bwa/blob/master/bwamem_pair.c#L93

https://github.com/lh3/bwa/blob/master/bwamem_pair.c#L99

ADD COMMENTlink written 4 months ago by Pierre Lindenbaum117k

So, The answer is Yes it takes insert size in consideration and it depend on the batch that the read belongs to (in such case 6 will be proper insert size even though it does not fit to overall average of insert sizes in file).

ADD REPLYlink written 4 months ago by Medhat8.2k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1708 users visited in the last hour