Renaming fasta files with chromosomes

Question

[namea38]

I have a .fasta file that I'm trying to use bedtools getfasta on. When I run it I get the error

WARNING. chromosome (N) was not found in the FASTA file. Skipping.

which I think is because my .fasta headers look like this

>HWI-D00270:252:CB1D5ANXX:8:1303:19141:48584/1
ACAGCTGATTAGACACAATGTCAACAAAGTACTGAAGACCAGAGAAAAACACTTATTATACTC
TTTGTTTTCAGGTGTGGAATGTGCTTTCTACCACGGCTACAAATACTACAAAGGATGTAGTA

and not like this

>chrI
ACAGCTGATTAGACACAATGTCAACAAAGTACTGAAGACCAGAGAAAAACACTTATTATACTC
TTTGTTTTCAGGTGTGGAATGTGCTTTCTACCACGGCTACAAATACTACAAAGGATGTAGTA

Is there a way I can edit the header to reflect only the chromosome.

[GenoMax]

You appear to have Illumina reads converted into fasta format in first example. That does not appear to be chromosome data at all.

Are you using a bed file for the intervals? What does it look like?

[namea38]

I have a bed file I downloaded from the USCS genome browser

chrI 2653 2738 (TAG)n 322 +

chrI 2974 3011 AT_rich 30 +

chrI 3034 3069 AT_rich 21 +

[GenoMax]

Why are you using a file with Illumina read data in fasta format instead of using the genome sequence file from UCSC? I assume you want to retrieve the fasta sequence corresponding to those intervals?

[namea38]

Yeah I'm trying to use the DNA my lab sequenced from a particular region to look for transposons