Entering edit mode
5.4 years ago
namea38
•
0
I have a .fasta file that I'm trying to use bedtools getfasta
on. When I run it I get the error
WARNING. chromosome (N) was not found in the FASTA file. Skipping.
which I think is because my .fasta headers look like this
>HWI-D00270:252:CB1D5ANXX:8:1303:19141:48584/1
ACAGCTGATTAGACACAATGTCAACAAAGTACTGAAGACCAGAGAAAAACACTTATTATACTC
TTTGTTTTCAGGTGTGGAATGTGCTTTCTACCACGGCTACAAATACTACAAAGGATGTAGTA
and not like this
>chrI
ACAGCTGATTAGACACAATGTCAACAAAGTACTGAAGACCAGAGAAAAACACTTATTATACTC
TTTGTTTTCAGGTGTGGAATGTGCTTTCTACCACGGCTACAAATACTACAAAGGATGTAGTA
Is there a way I can edit the header to reflect only the chromosome.
You appear to have Illumina reads converted into fasta format in first example. That does not appear to be chromosome data at all.
Are you using a bed file for the intervals? What does it look like?
I have a bed file I downloaded from the USCS genome browser
Why are you using a file with Illumina read data in fasta format instead of using the genome sequence file from UCSC? I assume you want to retrieve the fasta sequence corresponding to those intervals?
Yeah I'm trying to use the DNA my lab sequenced from a particular region to look for transposons