Question: how to convert a fasta file to a PAML input file (nuc format) ?
0
gravatar for sunnykevin97
2.0 years ago by
sunnykevin97140
sunnykevin97140 wrote:

Hi I have CDS sequences for the genome datasets.

How to convert fasta to a .nuc format file (used for a running PAML) ?

fasta format
>chr9:94400443-94400608
CTGCTGCCCCACTTGATGCCCAGCTCCTGGCCATAGTTGTCCCCATACGAGACCAGCAGCTCACAGCCAGGCTGGATGGTGCGGCAAGTCCAGTAGAAGATCTGCCTGTGGTACTGAAAGGCCACTAGGTTCTGCTCCTCCTTGTCCCGGGTGCAGTTCACATAC
>chr9:94401663-94401731
CTCATCTGGTTGGCCCAAGGCTCGTCCTTTCCATCCACATACTTATAGCAGTTCCTCCTCTTGGTGAT
>chr9:94402051-94402320
CAGCCAGGAGTAGCCACTGTTGGCTGCCTCGTCTTCTGTCACCTGGCCCTTATAGGGGCCAAAGTGCAGACCCAGTAGCTGCTCGGACACCTCATACCATACTCTGAGCCCAGCCTCAGGGATGCTGGATGGCCCAATTCTCAGTCCAGGGGGCAGAGTGAGGGCTGAGTGATTGGGGTGCCCCCTGTCTACAGGGCTGTCCTTTACAAACATTGGGGCCCTATGAACTGCACAGGTGTCGATGAAAAAGTTCTGGCACTTCTCACAAT
>chr9:94402490-94402563
AAAGGTAGTCATCATTCTGGGGCTCACCGACCTCCTGGTACTCGAGGCCCTTTCTTTCTCGCAGGCTGTACAT

nuc format

head brown.nuc 
      5   895
Human
AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGACTTACATCCTCATTACTATT
CTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGG
ACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCT
Monkey
CGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTC
CTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTC
CCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAA
gorilla
ACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCT
ATCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAAC
snp alignment • 1.0k views
ADD COMMENTlink written 2.0 years ago by sunnykevin97140

What have you attempted so far?

ADD REPLYlink written 2.0 years ago by Joe18k

From aligned bam files, I called variants. Based on the reference genome annotation for each genome I modified the fasta sequences and generated CDS for all genomes (~18) what would be the next step ?

ADD REPLYlink modified 2.0 years ago • written 2.0 years ago by sunnykevin97140
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 983 users visited in the last hour