how to convert a fasta file to a PAML input file (nuc format) ?
0
0
Entering edit mode
2.3 years ago
sunnykevin97 ▴ 380

Hi I have CDS sequences for the genome datasets.

How to convert fasta to a .nuc format file (used for a running PAML) ?

fasta format
>chr9:94400443-94400608
CTGCTGCCCCACTTGATGCCCAGCTCCTGGCCATAGTTGTCCCCATACGAGACCAGCAGCTCACAGCCAGGCTGGATGGTGCGGCAAGTCCAGTAGAAGATCTGCCTGTGGTACTGAAAGGCCACTAGGTTCTGCTCCTCCTTGTCCCGGGTGCAGTTCACATAC
>chr9:94401663-94401731
CTCATCTGGTTGGCCCAAGGCTCGTCCTTTCCATCCACATACTTATAGCAGTTCCTCCTCTTGGTGAT
>chr9:94402051-94402320
CAGCCAGGAGTAGCCACTGTTGGCTGCCTCGTCTTCTGTCACCTGGCCCTTATAGGGGCCAAAGTGCAGACCCAGTAGCTGCTCGGACACCTCATACCATACTCTGAGCCCAGCCTCAGGGATGCTGGATGGCCCAATTCTCAGTCCAGGGGGCAGAGTGAGGGCTGAGTGATTGGGGTGCCCCCTGTCTACAGGGCTGTCCTTTACAAACATTGGGGCCCTATGAACTGCACAGGTGTCGATGAAAAAGTTCTGGCACTTCTCACAAT
>chr9:94402490-94402563
AAAGGTAGTCATCATTCTGGGGCTCACCGACCTCCTGGTACTCGAGGCCCTTTCTTTCTCGCAGGCTGTACAT

nuc format

head brown.nuc 
      5   895
Human
AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGACTTACATCCTCATTACTATT
CTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGG
ACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCT
Monkey
CGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTC
CTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTC
CCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAA
gorilla
ACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCT
ATCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAAC
alignment SNP • 1.2k views
ADD COMMENT
0
Entering edit mode

What have you attempted so far?

ADD REPLY
0
Entering edit mode

From aligned bam files, I called variants. Based on the reference genome annotation for each genome I modified the fasta sequences and generated CDS for all genomes (~18) what would be the next step ?

ADD REPLY

Login before adding your answer.

Traffic: 2158 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6