Question: how to convert a fasta file to a PAML input file (nuc format) ?
0
gravatar for sunnykevin97
6 months ago by
sunnykevin9710
sunnykevin9710 wrote:

Hi I have CDS sequences for the genome datasets.

How to convert fasta to a .nuc format file (used for a running PAML) ?

fasta format
>chr9:94400443-94400608
CTGCTGCCCCACTTGATGCCCAGCTCCTGGCCATAGTTGTCCCCATACGAGACCAGCAGCTCACAGCCAGGCTGGATGGTGCGGCAAGTCCAGTAGAAGATCTGCCTGTGGTACTGAAAGGCCACTAGGTTCTGCTCCTCCTTGTCCCGGGTGCAGTTCACATAC
>chr9:94401663-94401731
CTCATCTGGTTGGCCCAAGGCTCGTCCTTTCCATCCACATACTTATAGCAGTTCCTCCTCTTGGTGAT
>chr9:94402051-94402320
CAGCCAGGAGTAGCCACTGTTGGCTGCCTCGTCTTCTGTCACCTGGCCCTTATAGGGGCCAAAGTGCAGACCCAGTAGCTGCTCGGACACCTCATACCATACTCTGAGCCCAGCCTCAGGGATGCTGGATGGCCCAATTCTCAGTCCAGGGGGCAGAGTGAGGGCTGAGTGATTGGGGTGCCCCCTGTCTACAGGGCTGTCCTTTACAAACATTGGGGCCCTATGAACTGCACAGGTGTCGATGAAAAAGTTCTGGCACTTCTCACAAT
>chr9:94402490-94402563
AAAGGTAGTCATCATTCTGGGGCTCACCGACCTCCTGGTACTCGAGGCCCTTTCTTTCTCGCAGGCTGTACAT

nuc format

head brown.nuc 
      5   895
Human
AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGACTTACATCCTCATTACTATT
CTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGG
ACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCT
Monkey
CGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTC
CTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTC
CCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAA
gorilla
ACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCT
ATCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAAC
snp alignment • 232 views
ADD COMMENTlink written 6 months ago by sunnykevin9710

What have you attempted so far?

ADD REPLYlink written 6 months ago by jrj.healey13k

From aligned bam files, I called variants. Based on the reference genome annotation for each genome I modified the fasta sequences and generated CDS for all genomes (~18) what would be the next step ?

ADD REPLYlink modified 6 months ago • written 6 months ago by sunnykevin9710
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1668 users visited in the last hour