Question: Aligning Two Proteins With Their Domains/Annotations
7
gravatar for Pierre Lindenbaum
8.3 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum117k wrote:

Hi all,

I'd like to align two peptides 'A' & 'B':

  • 'A' is an annotated entry from swissprot
  • 'B' is a mutated form of 'A'

In the alignment, I'd like to see where are the domains/annotations from 'A' overlapping 'B'.

Something that would look like this:

            <===========> Zinc Finger
                                 <=========> TPR Domain
WILD: LAATHEFKQA CQLCYPKTGP RAGDYTYREG LEHKCKRDIL
    : |||||||||| ||| |||||| |||||||||| ||||||||||
MUT : LAATHEFKQA CQLGYPKTGP RAGDYTYREG LEHKCKRDIL

do you know if such tool exists ?

Thanks,

Pierre

annotation alignment protein • 2.1k views
ADD COMMENTlink modified 7.9 years ago by Michael Schubert6.9k • written 8.3 years ago by Pierre Lindenbaum117k
2

this question was featured in http://www.slideshare.net/lindenb/notch2-backstage

ADD REPLYlink written 7.9 years ago by Pierre Lindenbaum117k
9
gravatar for Alastair Kerr
8.3 years ago by
Alastair Kerr5.2k
The University of Edinburgh, UK
Alastair Kerr5.2k wrote:

Jalview will be able to show this. You can read in the features from your own feature file (e.g. gff) or from your own DAS server.

ADD COMMENTlink modified 8.3 years ago • written 8.3 years ago by Alastair Kerr5.2k
5
gravatar for Darked89
8.3 years ago by
Darked894.2k
Barcelona, Spain
Darked894.2k wrote:

If your protein is in PDB or Uniprot you may try SPICE (also DAS based):

http://www.dasregistry.org/spice/index.shtml

ADD COMMENTlink written 8.3 years ago by Darked894.2k
3
gravatar for Pierre Lindenbaum
8.3 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum117k wrote:

I've answered to my own question through this post: http://plindenbaum.blogspot.com/2010/11/blastxmlannotations.html

My tools reads a BLAST/XML files, search for the annotations in Genbank and displays the alignments:

QUERY: Homo sapiens eukaryotic translation initiation factor 4 gamma, 1 (EIF4G1), transcript variant 2, mRNA
       ID:gi|303227906|ref|NM_198241.2| Len:5538
>Mus musculus eukaryotic translation initiation factor 4, gamma 1 (Eif4g1), transcript variant 2, mRNA
 NM_001005331
 id:gi|56699433|ref|NM_001005331.1| len:5460

   e-value:0 gap:138 bitScore:6818.02

                #####:############################################ exon 1..180 gene:EIF4G1 
QUERY 000000053 GGCGCCGGCTGCGCCTGCGGAGAAGCGGTGGCCGCCGAGCGGGATCTGTG 000000102
                ||||| ||||||||||||||||||||||||||||||||||||||||||||
HIT   000000001 GGCGCTGGCTGCGCCTGCGGAGAAGCGGTGGCCGCCGAGCGGGATCTGTG 000000050
                #####:############################################ exon 1..128 gene:Eif4g1

                ################################################## exon 1..180 gene:EIF4G1 
QUERY 000000103 CGGGGAGCCGGAAATGGTTGTGGACTACGTCTGTGCGGCTGCGTGGGGCT 000000152
                ||||||||||||||||||||||||||||||||||||||||||||||||||
HIT   000000051 CGGGGAGCCGGAAATGGTTGTGGACTACGTCTGTGCGGCTGCGTGGGGCT 000000100
                ################################################## exon 1..128 gene:Eif4g1

                ############::::::::::######                       exon 1..180 gene:EIF4G1 
                                            #:::::::::::::###::::: exon 181..237 gene:EIF4G1 
QUERY 000000153 CGGCCGCGCGGACTGAAGGAGACTGAAGGCCCTCGGATGCCCAGAACCTG 000000202
                ||||||||||||          |||||||             |||     
HIT   000000101 CGGCCGCGCGGA----------CTGAAGG-------------AGA----- 000000122
                ############----------#######-------------###      gene 1..5460 gene:Eif4g1 
                ############----------#######-------------###      exon 1..128 gene:Eif4g1

                ::::::::::::::::::::::##:##:::::::#                exon 181..237 gene:EIF4G1 
                                                   ############### exon 238..331 gene:EIF4G1 
QUERY 000000203 TAGGCCGCACCGTGGACTTGTTCTTAATCGAGGGGGTGCTGGGGGGACCC 000000252
                                      || ||       ||||||||||||||||
HIT   000000123 ----------------------CTGAA-------GGTGCTGGGGGGACCC 000000143
                ----------------------##:##-------#                exon 1..128 gene:Eif4g1 
                                                   ############### exon 129..222 gene:Eif4g1

                #:###############################:###:############ exon 238..331 gene:EIF4G1 
                                   ##############:###:############ CDS 272..5071 gene:EIF4G1 
QUERY 000000253 TGATGTGGCACCAAATGAAATGAACAAAGCTCCACAGTCCACAGGCCCCC 000000302
                | ||||||||||||||||||||||||||||||| ||| ||||||||||||
HIT   000000144 TAATGTGGCACCAAATGAAATGAACAAAGCTCCCCAGCCCACAGGCCCCC 000000193
                #:###############################:###:############ exon 129..222 gene:Eif4g1 
                                   ##############:###:############ CDS 163..4944 gene:Eif4g1

 (...)

                ############:#:#:#####:######:#:########:##:###### exon 4890..5521 gene:EIF4G1 
                ############:#:#:#####:######:#:########:##:###### STS 4948..5505 gene:EIF4G1 
                ############:#:#:#####:######:#:########:##:###### STS 5174..5403 gene:EIF4G1 
QUERY 000005319 TTGGTGTGTCTTGGGGTGGGGAGGGGCACCAACGCCTGCCCCTGGGGTCC 000005368
                |||||||||||| | | ||||| |||||| | |||||||| || ||||||
HIT   000005201 TTGGTGTGTCTTTGCGGGGGGAAGGGCACTACCGCCTGCCTCTAGGGTCC 000005250
                ############:#:#:#####:######:#:########:##:###### exon 4760..5396 gene:Eif4g1

                ::##############:##########:###################### exon 4890..5521 gene:EIF4G1 
                ::##############:##########:###################### STS 4948..5505 gene:EIF4G1 
                ::##############:##########:#######                STS 5174..5403 gene:EIF4G1 
QUERY 000005369 TTTTTTTTATTTTCTGAAAATCACTCTCGGGACTGCCGTCCTCGCTGCTG 000005418
                  |||||||||||||| |||||||||| ||||||||||||||||||||||
HIT   000005251 --TTTTTTATTTTCTG-AAATCACTCTTGGGACTGCCGTCCTCGCTGCTG 000005297
                --##############-##########:###################### exon 4760..5396 gene:Eif4g1

                ######################:#############:############# exon 4890..5521 gene:EIF4G1 
                ######################:#############:############# STS 4948..5505 gene:EIF4G1 
QUERY 000005419 GGGGCATATGCCCCAGCCCCTGTACCACCCCTGCTGTTGCCTGGGCAGGG 000005468
                |||||||||||||||||||||| ||||||||||||| |||||||||||||
HIT   000005298 GGGGCATATGCCCCAGCCCCTGCACCACCCCTGCTGCTGCCTGGGCAGGG 000005347
                ######################:#############:############# exon 4760..5396 gene:Eif4g1

                #:##-############################################: exon 4890..5521 gene:EIF4G1 
                #:##-#################################             STS 4948..5505 gene:EIF4G1 
                                            ######                 polyA_signal 5496..5501 gene:EIF4G1 
                                                                #  polyA_site 5516 gene:EIF4G1 
QUERY 000005469 GGAA-GGGGGGGCACGGTGCCTGTAATTATTAAACATGAATTCAATTAAG 000005517
                | || |||||||||||||||||||||||||||||||||||||||||||| 
HIT   000005348 GAAAGGGGGGGGCACGGTGCCTGTAATTATTAAACATGAATTCAATTAAA 000005397
                #:##:############################################  exon 4760..5396 gene:Eif4g1

                :::#                  exon 4890..5521 gene:EIF4G1 
                   #                  polyA_site 5521 gene:EIF4G1 
QUERY 000005518 CTCAAAAAAAAAAAAAAAAAA 000005538
                   ||||||||||||||||||
HIT   000005398 AAAAAAAAAAAAAAAAAAAAA 000005418
ADD COMMENTlink written 8.3 years ago by Pierre Lindenbaum117k
1
gravatar for Michael Schubert
7.9 years ago by
Cambridge, UK
Michael Schubert6.9k wrote:

For reference and because I was/am facing a similar problem: jsDAS

jsDAS is a javascript client library for DAS. It offers web developers full access to the data contained in the DAS network from inside the browser. It takes care of the communication with the servers and the data parsing and offers a simple yet powerful API to access all the received data.

ADD COMMENTlink written 7.9 years ago by Michael Schubert6.9k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 699 users visited in the last hour