Question: What sequences should I use for ATAC-Seq adapter trimming using trimmomatic 0.36?
0
gravatar for Gary
7 months ago by
Gary450
Taiwan/Taichung/China Medical University Hospital
Gary450 wrote:

Hi,

I want to use Trimmomatic 0.36 to trim ATAC-Seq adapter sequences. However, I am not sure which sequences I should use to trim our fastq files. Should I use the NexteraPE-PE.fa file provided by Trimmomatic 0.36 based on two Biostars threads below?

Biostars thread I: The only odd thing I see is that you trimmed for the TruSeq instead of the Nextera adapter.

ATAC-seq fragment length distribution

Biostars thread II: I chose Trimmomatic in the galaxy of my university (Illuminaclip Nextera pair end adapter) to trim my fastq file

How to treat the unpaired data after trimmomatic

By the way, I have tried (1) NexteraPE-PE.fa provided by Trimmomatic (the detail below), and (2) ATACseq.fa, including Ad1_noMX & Ad2.5_GGACTCCT primers we used (the detail below). Below are their commands and results. Could you help me? May you share the correct sequence file with me for ATAC-Seq adapter trimming using Trimmomatic? Thank you very much.

Trimmomatic commands & results I. using NexteraPE-PE.fa provided by Trimmomatic

gary > java -jar /Users/gary/Applications/Trimmomatic-0.36/trimmomatic-0.36.jar PE -threads 6 -trimlog ATACseqNexteraPE.txt -phred33 bulbul_R1.fastq.gz bulbul_R2.fastq.gz bulbul_R1_paired.fastq.gz bulbul_R1_unpaired.fastq.gz bulbul_R2_paired.fastq.gz bulbul_R2_unpaired.fastq.gz ILLUMINACLIP:/Users/gary/Applications/Trimmomatic-0.36/adapters/NexteraPE-PE.fa:2:30:10:8:true
TrimmomaticPE: Started with arguments:
 -threads 6 -trimlog ATACseqNexteraPE.txt -phred33 bulbul_R1.fastq.gz bulbul_R2.fastq.gz bulbul_R1_paired.fastq.gz bulbul_R1_unpaired.fastq.gz bulbul_R2_paired.fastq.gz bulbul_R2_unpaired.fastq.gz ILLUMINACLIP:/Users/gary/Applications/Trimmomatic-0.36/adapters/NexteraPE-PE.fa:2:30:10:8:true
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 26847985 Both Surviving: 26759022 (99.67%) Forward Only Surviving: 22244 (0.08%) Reverse Only Surviving: 64789 (0.24%) Dropped: 1930 (0.01%)
TrimmomaticPE: Completed successfully

II. Using ATACseq.fa, including Ad1_noMX & Ad2.5_GGACTCCT primers

gary > java -jar /Users/gary/Applications/Trimmomatic-0.36/trimmomatic-0.36.jar PE -threads 6 -trimlog ATACseq.txt -phred33 bulbul_R1.fastq.gz bulbul_R2.fastq.gz bulbul_R1_paired.fastq.gz bulbul_R1_unpaired.fastq.gz bulbul_R2_paired.fastq.gz bulbul_R2_unpaired.fastq.gz ILLUMINACLIP:/Users/gary/Applications/Trimmomatic-0.36/adapters/ATACseq.fa:2:30:10:8:true
TrimmomaticPE: Started with arguments:
 -threads 6 -trimlog ATACseq.txt -phred33 bulbul_R1.fastq.gz bulbul_R2.fastq.gz bulbul_R1_paired.fastq.gz bulbul_R1_unpaired.fastq.gz bulbul_R2_paired.fastq.gz bulbul_R2_unpaired.fastq.gz ILLUMINACLIP:/Users/gary/Applications/Trimmomatic-0.36/adapters/ATACseq.fa:2:30:10:8:true
Using Long Clipping Sequence: 'CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGAGATGT'
Using Long Clipping Sequence: 'AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 26847985 Both Surviving: 26842135 (99.98%) Forward Only Surviving: 5290 (0.02%) Reverse Only Surviving: 557 (0.00%) Dropped: 3 (0.00%)
TrimmomaticPE: Completed successfully

Supplementary Table 1 of Buenrostro, et al (2013): Oligo designs. A list of ATAC-seq oligos used for PCR. Buenrostro JD, Giresi PG, Zaba LC, Chang HY, Greenleaf WJ. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods 2013;10(12):1213-8.

Ad1_noMX:
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG

Ad2.1_TAAGGCGA
CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT
Ad2.2_CGTACTAG
CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT
Ad2.3_AGGCAGAA
CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT
Ad2.4_TCCTGAGC
CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGAGATGT
Ad2.5_GGACTCCT
CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGAGATGT
Ad2.6_TAGGCATG
CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGGAGATGT
Ad2.7_CTCTCTAC
CAAGCAGAAGACGGCATACGAGATGTAGAGAGGTCTCGTGGGCTCGGAGATGT
Ad2.8_CAGAGAGG
CAAGCAGAAGACGGCATACGAGATCCTCTCTGGTCTCGTGGGCTCGGAGATGT
Ad2.9_GCTACGCT
CAAGCAGAAGACGGCATACGAGATAGCGTAGCGTCTCGTGGGCTCGGAGATGT
Ad2.10_CGAGGCTG
CAAGCAGAAGACGGCATACGAGATCAGCCTCGGTCTCGTGGGCTCGGAGATGT
Ad2.11_AAGAGGCA
CAAGCAGAAGACGGCATACGAGATTGCCTCTTGTCTCGTGGGCTCGGAGATGT
Ad2.12_GTAGAGGA
CAAGCAGAAGACGGCATACGAGATTCCTCTACGTCTCGTGGGCTCGGAGATGT
Ad2.13_GTCGTGAT
CAAGCAGAAGACGGCATACGAGATATCACGACGTCTCGTGGGCTCGGAGATGT
Ad2.14_ACCACTGT
CAAGCAGAAGACGGCATACGAGATACAGTGGTGTCTCGTGGGCTCGGAGATGT
Ad2.15_TGGATCTG
CAAGCAGAAGACGGCATACGAGATCAGATCCAGTCTCGTGGGCTCGGAGATGT
Ad2.16_CCGTTTGT
CAAGCAGAAGACGGCATACGAGATACAAACGGGTCTCGTGGGCTCGGAGATGT
Ad2.17_TGCTGGGT
CAAGCAGAAGACGGCATACGAGATACCCAGCAGTCTCGTGGGCTCGGAGATGT
Ad2.18_GAGGGGTT
CAAGCAGAAGACGGCATACGAGATAACCCCTCGTCTCGTGGGCTCGGAGATGT
Ad2.19_AGGTTGGG
CAAGCAGAAGACGGCATACGAGATCCCAACCTGTCTCGTGGGCTCGGAGATGT
Ad2.20_GTGTGGTG
CAAGCAGAAGACGGCATACGAGATCACCACACGTCTCGTGGGCTCGGAGATGT
Ad2.21_TGGGTTTC
CAAGCAGAAGACGGCATACGAGATGAAACCCAGTCTCGTGGGCTCGGAGATGT
Ad2.22_TGGTCACA
CAAGCAGAAGACGGCATACGAGATTGTGACCAGTCTCGTGGGCTCGGAGATGT
Ad2.23_TTGACCCT
CAAGCAGAAGACGGCATACGAGATAGGGTCAAGTCTCGTGGGCTCGGAGATGT
Ad2.24_CCACTCCT
CAAGCAGAAGACGGCATACGAGATAGGAGTGGGTCTCGTGGGCTCGGAGATGT

Best,

Gary

ADD COMMENTlink modified 7 months ago by h.mon27k • written 7 months ago by Gary450
1

Please use the code button to format code, commands and such.

101010 Button

I formatted part of your post, to provide an example.

ADD REPLYlink modified 7 months ago • written 7 months ago by h.mon27k

Many thanks for your information.

ADD REPLYlink written 7 months ago by Gary450
1

By the way, if you quote content from another threat, please use to " quote function in the formatting bar. I see you quoted a comment of mine but did not indicate it as such. Not a serious problem, but it helps people distinguish your content from those of other threads. In this case:

The only odd thing I see is that you trimmed for the TruSeq instead of the Nextera adapter.

ADD REPLYlink written 7 months ago by ATpoint24k

Dear ATpoint, Sure, I have quoted them. Many thanks for your help. However, I don't understand that I trimmed the TruSeq instead of the Nextera adapter. Could you explain it more clearly to me? Thank you so much. Best, Gary

ADD REPLYlink written 7 months ago by Gary450
1

The only odd thing I see is that you trimmed for the TruSeq instead of the Nextera adapter.

is a quote from a previous thread which you did not indicate. It has nothing to do with this thread here.

CTGTCTCTTATACACATCT is for ATAC-seq

ADD REPLYlink modified 7 months ago • written 7 months ago by ATpoint24k
2
gravatar for ATpoint
7 months ago by
ATpoint24k
Germany
ATpoint24k wrote:

The transposase introduces the Nextera adapter sequence, therefore use CTGTCTCTTATACACATCT for both the forward and reverse trimming.

ADD COMMENTlink written 7 months ago by ATpoint24k

Is any TN5 requiring this sequence to be functional? CTGTCTCTTATACACATCT

Is there any paper about this sequence and how did people identify this sequence?

Thanks, Yichao

ADD REPLYlink modified 3 months ago • written 3 months ago by liyc.stjude0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 769 users visited in the last hour