Question: Chunks erros with STAR aligner
0
gravatar for Morris_Chair
11 weeks ago by
Morris_Chair110
ISBReMIT
Morris_Chair110 wrote:

Hello everyone, I’m always “lucky” to catch all the kind of errors in my paths… I run star as I did in the past without many problems, but with this files I have a new issue.. it might be because the reads are too long? Does anybody dealt with this problem before?

STAR --genomeDir genome/Indexed_star/ --runThreadN 4 --readFilesIn /home/RNAseq/fastq_files/file.R1.fq --outFileNamePrefix mapping/star/file.R1. --outSAMattributes All --outSAMtype BAM SortedByCoordinate --quantMode GeneCounts --outFilterMismatchNmax 100



Apr 09 20:17:44 ..... started STAR run
Apr 09 20:17:44 ..... loading genome
Apr 09 20:19:42 ..... started mapping

ReadAlignChunk_processChunks.cpp:171:processChunks EXITING because of FATAL ERROR in input reads: unknown file format: the read ID should start with @ or >

Apr 09 20:19:43 ...... FATAL ERROR, exiting
Segmentation fault (core dumped)

The read start with @ anyways, after trimming I woulnd't expect does N ..

@K00124:54:HTMMCBBXX:1:1101:8968:993 1:N:0:NCGTCC
NGCATCTCAATTTGGAATCCATTAATTCATCAGGTTTTGCCTCTTTCCACACAGCTTCCATATCTGAAGTGTTTGGTGGAGCAAAAATA
+

Thank you for help

rna-seq star • 185 views
ADD COMMENTlink modified 10 weeks ago • written 11 weeks ago by Morris_Chair110
1

what are the outputs of

file /home/RNAseq/fastq_files/file.R1.fq

cat /home/RNAseq/fastq_files/file.R1.fq | paste - - - - | wc -l

cat /home/RNAseq/fastq_files/file.R1.fq | paste - - - - | cut -f 1| cut -c 1 | uniq | sort | uniq
ADD REPLYlink written 11 weeks ago by Pierre Lindenbaum121k

Hi Pierre, This are:

cat file.R1.fq | paste - - - - | wc -l
22913861

file file.R1.fq
file.R1.fq: ASCII text

cat file.R1.fq | paste - - - - | cut -f 1| cut -c 1 | uniq | sort | uniq
@

Merci

ADD REPLYlink modified 11 weeks ago • written 11 weeks ago by Morris_Chair110
1

and wc -l file.R1.fq please

ADD REPLYlink written 11 weeks ago by Pierre Lindenbaum121k

Hi Pierre, I also counted the number of reads and the number of @ to see if there are reads with no @ and the number is the same

echo $(cat file.R1.fq|wc -l)/4|bc
30816907
grep "@" file.R1.fq | wc -l
30816907
ADD REPLYlink modified 11 weeks ago • written 11 weeks ago by Morris_Chair110
1

The read start with @ anyways, after trimming I woulnd't expect does N ..

Not true. Unless you had trimmed to remove N's they remain. Some reads at the beginning of the file may have these N's (or are they present in each and every read)?

ADD REPLYlink modified 11 weeks ago • written 11 weeks ago by genomax68k

No they are not present in all the reads but for sure on the first 100 reads or so

thanks

ADD REPLYlink modified 11 weeks ago • written 11 weeks ago by Morris_Chair110
wc -l file.R1.fq
91655444 file.R1.fq

tnx

ADD REPLYlink modified 11 weeks ago • written 11 weeks ago by Morris_Chair110
0
gravatar for Morris_Chair
10 weeks ago by
Morris_Chair110
ISBReMIT
Morris_Chair110 wrote:

Problem Solved !!! I installed the most updated version of STAR,

STAR-2.7.0f.tar

I hope this will help other people too

Cheers,

ADD COMMENTlink written 10 weeks ago by Morris_Chair110
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1605 users visited in the last hour